Multiple sequence alignment - TraesCS3D01G095800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G095800 chr3D 100.000 2254 0 0 1 2254 48686631 48688884 0 4163
1 TraesCS3D01G095800 chr6D 97.436 1404 31 5 856 2254 389254383 389252980 0 2388
2 TraesCS3D01G095800 chr6D 97.293 1404 33 5 856 2254 389249588 389248185 0 2377
3 TraesCS3D01G095800 chr5D 97.293 1404 32 6 856 2254 503238240 503236838 0 2377
4 TraesCS3D01G095800 chr5D 97.293 1404 32 6 856 2254 503242489 503241087 0 2377
5 TraesCS3D01G095800 chr5D 97.218 1402 34 5 856 2252 503228462 503227061 0 2368
6 TraesCS3D01G095800 chr5D 97.015 1407 31 6 853 2254 503268085 503269485 0 2355
7 TraesCS3D01G095800 chr5D 98.244 854 15 0 1 854 386466196 386467049 0 1495
8 TraesCS3D01G095800 chr7B 97.222 1404 34 5 856 2254 662723618 662722215 0 2372
9 TraesCS3D01G095800 chr3A 97.157 1407 34 6 853 2254 66007915 66009320 0 2372
10 TraesCS3D01G095800 chrUn 97.088 1408 32 6 853 2254 216508901 216510305 0 2364
11 TraesCS3D01G095800 chr1D 98.712 854 10 1 1 853 205418219 205417366 0 1515
12 TraesCS3D01G095800 chr1D 98.476 853 13 0 1 853 356793312 356792460 0 1504
13 TraesCS3D01G095800 chr1D 98.476 853 13 0 1 853 448035205 448034353 0 1504
14 TraesCS3D01G095800 chr2D 98.361 854 13 1 1 853 70885709 70884856 0 1498
15 TraesCS3D01G095800 chr2D 98.359 853 13 1 1 853 149731291 149732142 0 1496
16 TraesCS3D01G095800 chr4D 98.359 853 13 1 1 853 340976557 340977408 0 1496
17 TraesCS3D01G095800 chr4D 98.244 854 14 1 1 854 107618622 107617770 0 1493
18 TraesCS3D01G095800 chr7D 98.244 854 15 0 1 854 511261702 511262555 0 1495


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G095800 chr3D 48686631 48688884 2253 False 4163.0 4163 100.0000 1 2254 1 chr3D.!!$F1 2253
1 TraesCS3D01G095800 chr6D 389248185 389254383 6198 True 2382.5 2388 97.3645 856 2254 2 chr6D.!!$R1 1398
2 TraesCS3D01G095800 chr5D 503236838 503242489 5651 True 2377.0 2377 97.2930 856 2254 2 chr5D.!!$R2 1398
3 TraesCS3D01G095800 chr5D 503227061 503228462 1401 True 2368.0 2368 97.2180 856 2252 1 chr5D.!!$R1 1396
4 TraesCS3D01G095800 chr5D 503268085 503269485 1400 False 2355.0 2355 97.0150 853 2254 1 chr5D.!!$F2 1401
5 TraesCS3D01G095800 chr5D 386466196 386467049 853 False 1495.0 1495 98.2440 1 854 1 chr5D.!!$F1 853
6 TraesCS3D01G095800 chr7B 662722215 662723618 1403 True 2372.0 2372 97.2220 856 2254 1 chr7B.!!$R1 1398
7 TraesCS3D01G095800 chr3A 66007915 66009320 1405 False 2372.0 2372 97.1570 853 2254 1 chr3A.!!$F1 1401
8 TraesCS3D01G095800 chrUn 216508901 216510305 1404 False 2364.0 2364 97.0880 853 2254 1 chrUn.!!$F1 1401
9 TraesCS3D01G095800 chr1D 205417366 205418219 853 True 1515.0 1515 98.7120 1 853 1 chr1D.!!$R1 852
10 TraesCS3D01G095800 chr1D 356792460 356793312 852 True 1504.0 1504 98.4760 1 853 1 chr1D.!!$R2 852
11 TraesCS3D01G095800 chr1D 448034353 448035205 852 True 1504.0 1504 98.4760 1 853 1 chr1D.!!$R3 852
12 TraesCS3D01G095800 chr2D 70884856 70885709 853 True 1498.0 1498 98.3610 1 853 1 chr2D.!!$R1 852
13 TraesCS3D01G095800 chr2D 149731291 149732142 851 False 1496.0 1496 98.3590 1 853 1 chr2D.!!$F1 852
14 TraesCS3D01G095800 chr4D 340976557 340977408 851 False 1496.0 1496 98.3590 1 853 1 chr4D.!!$F1 852
15 TraesCS3D01G095800 chr4D 107617770 107618622 852 True 1493.0 1493 98.2440 1 854 1 chr4D.!!$R1 853
16 TraesCS3D01G095800 chr7D 511261702 511262555 853 False 1495.0 1495 98.2440 1 854 1 chr7D.!!$F1 853

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
155 156 0.30776 GCCCATTAATGTCGGCGAAG 59.692 55.0 12.92 0.0 0.0 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1562 5815 0.320374 CTGTCGGCACCAGTCCTAAA 59.68 55.0 0.0 0.0 0.0 1.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 0.307760 GCCCATTAATGTCGGCGAAG 59.692 55.000 12.92 0.00 0.00 3.79
177 178 1.214305 TCATGGGCCTTTAGCTGGGT 61.214 55.000 4.53 0.00 43.05 4.51
451 452 3.181479 ACGTGTCAACATATCATAGGCGT 60.181 43.478 0.00 0.00 0.00 5.68
584 585 3.007473 GGTTATCGGATCCAAAACCCA 57.993 47.619 21.41 0.00 34.75 4.51
1053 1056 4.079901 TCGATACTGGTAGGAGAAGAACCT 60.080 45.833 0.00 0.00 41.05 3.50
1109 1114 6.386927 AGAACCAAGTCAAGATGATATGGGTA 59.613 38.462 14.76 0.00 35.78 3.69
1145 1150 5.324409 TGTGCCAAAGATCTTACCATTTCT 58.676 37.500 8.75 0.00 0.00 2.52
1428 5681 6.232581 AGAAAGACTGATTCATTCGGATCT 57.767 37.500 0.00 2.28 37.08 2.75
1590 5844 1.298859 GGTGCCGACAGTTCATCACC 61.299 60.000 0.00 0.00 36.92 4.02
1605 5859 5.152623 TCATCACCGAAGAAAGAACTCAT 57.847 39.130 0.00 0.00 0.00 2.90
1611 5865 4.464597 ACCGAAGAAAGAACTCATAGAGCT 59.535 41.667 0.00 0.00 32.04 4.09
1629 5883 5.334421 AGAGCTGGGATCGGTAACTAATAT 58.666 41.667 0.00 0.00 0.00 1.28
1825 10874 2.101582 AGGTCATCGAAAAGATCTCGGG 59.898 50.000 0.00 0.00 37.52 5.14
1848 10897 0.662619 CTCACCAAAGCACGAAAGCA 59.337 50.000 0.00 0.00 36.85 3.91
1850 10899 1.474478 TCACCAAAGCACGAAAGCAAA 59.526 42.857 0.00 0.00 36.85 3.68
1908 10957 4.456911 CCGCATGGATAAGCTCACATTAAT 59.543 41.667 0.00 0.00 37.49 1.40
2004 11053 7.694093 AGATTCATACAGAGGAAAAGGTTCTT 58.306 34.615 0.00 0.00 33.92 2.52
2019 11068 5.705609 AGGTTCTTTATTGATGCAAACGT 57.294 34.783 0.00 0.00 0.00 3.99
2058 11108 4.660771 GGGATAGAGGAAGAGGGAAAATCA 59.339 45.833 0.00 0.00 0.00 2.57
2118 11169 5.526846 GTCAAAGATAGAAGAGCCCAGATTG 59.473 44.000 0.00 0.00 0.00 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 1.673168 CAGCTAAAGGCCCATGAGAC 58.327 55.000 0.00 0.00 43.05 3.36
177 178 1.003839 GCGGATCATAATGGGCCGA 60.004 57.895 13.15 0.00 44.43 5.54
314 315 2.223803 TTTTGCGGACCATAATGGGT 57.776 45.000 0.00 0.00 43.37 4.51
451 452 0.178767 CTCATCCAATGGGCGAGACA 59.821 55.000 11.80 0.00 36.21 3.41
691 693 8.499403 TGACATTACCAAAATTATCATCACGA 57.501 30.769 0.00 0.00 0.00 4.35
771 773 4.721132 TGTCATGCATGTACATCCATGAT 58.279 39.130 34.10 5.72 43.90 2.45
854 856 9.905713 TCCCATTATTTGACTATCCATAATAGC 57.094 33.333 0.00 0.00 41.04 2.97
1019 1022 6.776116 TCCTACCAGTATCGAATAGAACATGT 59.224 38.462 0.00 0.00 0.00 3.21
1077 1082 2.439507 TCTTGACTTGGTTCTGCTTCCT 59.560 45.455 0.00 0.00 0.00 3.36
1109 1114 0.398381 TGGCACAAGAAAAAGGGGCT 60.398 50.000 0.00 0.00 31.92 5.19
1124 1129 5.569355 TCAGAAATGGTAAGATCTTTGGCA 58.431 37.500 14.36 0.00 0.00 4.92
1145 1150 1.668826 ATGTAGCCCCAGTTCCTTCA 58.331 50.000 0.00 0.00 0.00 3.02
1325 5578 7.507956 TCTCGGTAGGACATGGATTTCTATTAA 59.492 37.037 0.00 0.00 0.00 1.40
1428 5681 3.323774 ACGGAGTTGGGTCCTCATATA 57.676 47.619 0.00 0.00 37.78 0.86
1517 5770 2.436109 GGGGCTCAGCAGGAACAA 59.564 61.111 0.00 0.00 0.00 2.83
1519 5772 2.432174 AAAGGGGGCTCAGCAGGAAC 62.432 60.000 0.00 0.00 0.00 3.62
1562 5815 0.320374 CTGTCGGCACCAGTCCTAAA 59.680 55.000 0.00 0.00 0.00 1.85
1590 5844 4.803088 CCAGCTCTATGAGTTCTTTCTTCG 59.197 45.833 0.00 0.00 31.39 3.79
1605 5859 2.750141 AGTTACCGATCCCAGCTCTA 57.250 50.000 0.00 0.00 0.00 2.43
1825 10874 1.495584 TTCGTGCTTTGGTGAGTCGC 61.496 55.000 0.00 0.00 0.00 5.19
1908 10957 4.142491 CGAATTGGATCCAAAATTGACGGA 60.142 41.667 30.28 4.46 39.55 4.69
2004 11053 5.950758 AGGTACAACGTTTGCATCAATAA 57.049 34.783 0.00 0.00 0.00 1.40
2019 11068 6.217900 CCTCTATCCCTATCCTCTAGGTACAA 59.782 46.154 0.00 0.00 36.34 2.41
2097 11148 4.080129 TGCAATCTGGGCTCTTCTATCTTT 60.080 41.667 0.00 0.00 0.00 2.52
2118 11169 5.460646 TCGAGTTTCCATTTCTTCATTTGC 58.539 37.500 0.00 0.00 0.00 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.