Multiple sequence alignment - TraesCS3D01G088000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G088000 chr3D 100.000 3053 0 0 1 3053 44904061 44901009 0 5638
1 TraesCS3D01G088000 chr7D 98.626 3056 33 5 1 3053 566029531 566032580 0 5402
2 TraesCS3D01G088000 chr6D 98.462 3055 36 5 1 3053 162291870 162288825 0 5371
3 TraesCS3D01G088000 chr6D 98.201 3058 42 6 1 3053 387589992 387586943 0 5330
4 TraesCS3D01G088000 chr6D 95.520 3058 93 25 1 3053 386957610 386954592 0 4848
5 TraesCS3D01G088000 chr6A 96.368 3056 96 12 1 3053 81248557 81251600 0 5014
6 TraesCS3D01G088000 chr6A 96.329 2969 87 13 88 3053 596155674 596152725 0 4859
7 TraesCS3D01G088000 chr6A 93.085 3066 177 23 1 3053 201652894 201649851 0 4455
8 TraesCS3D01G088000 chr1A 96.367 3055 93 13 1 3053 362042288 362045326 0 5011
9 TraesCS3D01G088000 chr7A 95.942 3056 111 13 1 3053 696231258 696234303 0 4944
10 TraesCS3D01G088000 chr1D 94.064 3066 145 28 1 3053 279091739 279088698 0 4619
11 TraesCS3D01G088000 chr2B 89.655 667 49 13 1 659 545764214 545764868 0 832


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G088000 chr3D 44901009 44904061 3052 True 5638 5638 100.000 1 3053 1 chr3D.!!$R1 3052
1 TraesCS3D01G088000 chr7D 566029531 566032580 3049 False 5402 5402 98.626 1 3053 1 chr7D.!!$F1 3052
2 TraesCS3D01G088000 chr6D 162288825 162291870 3045 True 5371 5371 98.462 1 3053 1 chr6D.!!$R1 3052
3 TraesCS3D01G088000 chr6D 387586943 387589992 3049 True 5330 5330 98.201 1 3053 1 chr6D.!!$R3 3052
4 TraesCS3D01G088000 chr6D 386954592 386957610 3018 True 4848 4848 95.520 1 3053 1 chr6D.!!$R2 3052
5 TraesCS3D01G088000 chr6A 81248557 81251600 3043 False 5014 5014 96.368 1 3053 1 chr6A.!!$F1 3052
6 TraesCS3D01G088000 chr6A 596152725 596155674 2949 True 4859 4859 96.329 88 3053 1 chr6A.!!$R2 2965
7 TraesCS3D01G088000 chr6A 201649851 201652894 3043 True 4455 4455 93.085 1 3053 1 chr6A.!!$R1 3052
8 TraesCS3D01G088000 chr1A 362042288 362045326 3038 False 5011 5011 96.367 1 3053 1 chr1A.!!$F1 3052
9 TraesCS3D01G088000 chr7A 696231258 696234303 3045 False 4944 4944 95.942 1 3053 1 chr7A.!!$F1 3052
10 TraesCS3D01G088000 chr1D 279088698 279091739 3041 True 4619 4619 94.064 1 3053 1 chr1D.!!$R1 3052
11 TraesCS3D01G088000 chr2B 545764214 545764868 654 False 832 832 89.655 1 659 1 chr2B.!!$F1 658

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
323 329 1.377987 GCCGGCCATAAGTGTGGAA 60.378 57.895 18.11 0.0 42.02 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2277 2302 2.371841 TCAGTATGGAGTTTGTGGCACT 59.628 45.455 19.83 0.0 36.16 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
284 289 1.614241 GGCGGCTGTTTCCTCTCCTA 61.614 60.000 0.00 0.0 0.00 2.94
323 329 1.377987 GCCGGCCATAAGTGTGGAA 60.378 57.895 18.11 0.0 42.02 3.53
327 333 2.495669 CCGGCCATAAGTGTGGAATTTT 59.504 45.455 2.24 0.0 42.02 1.82
328 334 3.056179 CCGGCCATAAGTGTGGAATTTTT 60.056 43.478 2.24 0.0 42.02 1.94
675 694 7.211897 TCTCCCTCATCTTATTTGGAATCAA 57.788 36.000 0.00 0.0 0.00 2.57
1214 1236 7.674120 CACCATATTCATCCAGATCTCAAGTA 58.326 38.462 0.00 0.0 0.00 2.24
1531 1553 8.367911 TCTATTCCGAGCTTATTCACATGTTAT 58.632 33.333 0.00 0.0 0.00 1.89
1617 1639 5.546499 ACAACCTTTACCTGAAGTCCATCTA 59.454 40.000 0.00 0.0 0.00 1.98
2277 2302 4.227300 AGGAATTATGCCTTGTGGACAGTA 59.773 41.667 0.00 0.0 34.57 2.74
2536 2563 4.823989 CCATGAAGACAACAAAGAGGAGTT 59.176 41.667 0.00 0.0 0.00 3.01
2537 2564 5.997746 CCATGAAGACAACAAAGAGGAGTTA 59.002 40.000 0.00 0.0 0.00 2.24
2538 2565 6.656693 CCATGAAGACAACAAAGAGGAGTTAT 59.343 38.462 0.00 0.0 0.00 1.89
2801 2828 3.607422 TCTTCTGATTTTGTGTGCACG 57.393 42.857 13.13 0.0 0.00 5.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
328 334 8.792830 TCAGAAAACAGAGAGAGAAAGAAAAA 57.207 30.769 0.00 0.00 0.00 1.94
333 339 7.727331 ATGTTCAGAAAACAGAGAGAGAAAG 57.273 36.000 0.00 0.00 33.18 2.62
395 406 9.095065 CAATCTAAGTACTAAACCGCACTAAAT 57.905 33.333 0.00 0.00 0.00 1.40
402 413 7.479150 AGTAGTCAATCTAAGTACTAAACCGC 58.521 38.462 0.00 0.00 32.40 5.68
675 694 6.595716 GCAGTAGATCACAACTCATTACCTTT 59.404 38.462 0.00 0.00 0.00 3.11
896 917 9.630098 ATGCAAAAATTTGATACTCAAGTGTAG 57.370 29.630 9.96 0.00 40.55 2.74
1087 1109 2.867793 ATTGCACGCGCTATCCCACA 62.868 55.000 5.73 0.00 39.64 4.17
2277 2302 2.371841 TCAGTATGGAGTTTGTGGCACT 59.628 45.455 19.83 0.00 36.16 4.40
2629 2656 2.772287 TGTATGCAACATGTTCCACGA 58.228 42.857 8.48 0.00 31.43 4.35
2757 2784 5.443185 TGAGGAAATTTTGACTCAAGCAG 57.557 39.130 14.78 0.00 37.06 4.24
2801 2828 1.949257 CTTTCCGGTGGCACAAGAC 59.051 57.895 20.82 0.25 44.16 3.01
2813 2840 2.159240 GGGCCTCAAAATTAGCTTTCCG 60.159 50.000 0.84 0.00 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.