Multiple sequence alignment - TraesCS3D01G070000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G070000 chr3D 100.000 3285 0 0 1 3285 31031667 31034951 0.000000e+00 6067
1 TraesCS3D01G070000 chr3D 98.935 3285 33 1 1 3285 31007292 31010574 0.000000e+00 5871
2 TraesCS3D01G070000 chr3D 97.693 2081 45 3 342 2421 30989567 30991645 0.000000e+00 3574
3 TraesCS3D01G070000 chr3D 97.147 736 20 1 2425 3159 30991945 30992680 0.000000e+00 1242
4 TraesCS3D01G070000 chr5D 96.291 3289 113 8 1 3285 542243695 542240412 0.000000e+00 5389
5 TraesCS3D01G070000 chr5D 96.186 944 33 3 2343 3285 542232653 542231712 0.000000e+00 1541
6 TraesCS3D01G070000 chr5D 97.692 130 2 1 1 130 509943093 509942965 4.270000e-54 222
7 TraesCS3D01G070000 chr7D 96.164 2763 91 5 1 2759 74468485 74465734 0.000000e+00 4501
8 TraesCS3D01G070000 chr7D 95.342 2383 107 4 1 2379 609646731 609644349 0.000000e+00 3783
9 TraesCS3D01G070000 chr7D 95.645 574 23 2 2714 3285 74465733 74465160 0.000000e+00 920
10 TraesCS3D01G070000 chr7D 91.704 446 33 4 2842 3283 609635221 609634776 1.670000e-172 616
11 TraesCS3D01G070000 chr7D 90.206 388 35 3 2374 2759 609635618 609635232 1.360000e-138 503
12 TraesCS3D01G070000 chr2D 94.423 2098 113 4 663 2756 15400105 15402202 0.000000e+00 3223
13 TraesCS3D01G070000 chr2D 96.252 507 19 0 1 507 15399604 15400110 0.000000e+00 832
14 TraesCS3D01G070000 chr2D 93.570 451 26 3 2836 3283 15402210 15402660 0.000000e+00 669
15 TraesCS3D01G070000 chr2B 94.313 1565 89 0 1384 2948 797775460 797777024 0.000000e+00 2398
16 TraesCS3D01G070000 chr2B 94.286 560 32 0 556 1115 797774906 797775465 0.000000e+00 857
17 TraesCS3D01G070000 chr2B 97.124 452 13 0 1 452 797774459 797774910 0.000000e+00 763
18 TraesCS3D01G070000 chr2B 93.204 412 27 1 2875 3285 797777026 797777437 3.630000e-169 604


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G070000 chr3D 31031667 31034951 3284 False 6067.000000 6067 100.000000 1 3285 1 chr3D.!!$F2 3284
1 TraesCS3D01G070000 chr3D 31007292 31010574 3282 False 5871.000000 5871 98.935000 1 3285 1 chr3D.!!$F1 3284
2 TraesCS3D01G070000 chr3D 30989567 30992680 3113 False 2408.000000 3574 97.420000 342 3159 2 chr3D.!!$F3 2817
3 TraesCS3D01G070000 chr5D 542240412 542243695 3283 True 5389.000000 5389 96.291000 1 3285 1 chr5D.!!$R3 3284
4 TraesCS3D01G070000 chr5D 542231712 542232653 941 True 1541.000000 1541 96.186000 2343 3285 1 chr5D.!!$R2 942
5 TraesCS3D01G070000 chr7D 609644349 609646731 2382 True 3783.000000 3783 95.342000 1 2379 1 chr7D.!!$R1 2378
6 TraesCS3D01G070000 chr7D 74465160 74468485 3325 True 2710.500000 4501 95.904500 1 3285 2 chr7D.!!$R2 3284
7 TraesCS3D01G070000 chr7D 609634776 609635618 842 True 559.500000 616 90.955000 2374 3283 2 chr7D.!!$R3 909
8 TraesCS3D01G070000 chr2D 15399604 15402660 3056 False 1574.666667 3223 94.748333 1 3283 3 chr2D.!!$F1 3282
9 TraesCS3D01G070000 chr2B 797774459 797777437 2978 False 1155.500000 2398 94.731750 1 3285 4 chr2B.!!$F1 3284

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
976 1096 1.913778 TGCTGGAATGACAAGCACAT 58.086 45.0 0.0 0.0 0.0 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2508 2931 2.028748 ACTACACGTGCCCGATTAAAGT 60.029 45.455 17.22 2.7 37.88 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 3.499338 TGTGTGGAGCAGAATGGAATTT 58.501 40.909 0.00 0.00 36.07 1.82
922 1042 6.098552 GGTTAGACTATATGATAAGAGGGCCC 59.901 46.154 16.46 16.46 0.00 5.80
976 1096 1.913778 TGCTGGAATGACAAGCACAT 58.086 45.000 0.00 0.00 0.00 3.21
1269 1393 5.124645 TGATGCTGCATCAATATACACACA 58.875 37.500 35.71 14.15 46.17 3.72
1584 1708 5.005490 GCAAGTCCGTAAGATAAGTAGTTGC 59.995 44.000 0.00 0.00 43.02 4.17
1706 1830 1.751544 GCAGGCATGGACATGAGCA 60.752 57.895 15.99 0.00 41.20 4.26
1765 1889 2.814805 ACCTCCTGCATATTGCTGTT 57.185 45.000 0.75 0.00 45.31 3.16
1847 1971 1.285023 GGCAAACTCACAGCTGCAG 59.715 57.895 15.27 10.11 36.50 4.41
2508 2931 4.502016 TCAAAATGCTTGAAAGTGCACAA 58.498 34.783 21.04 3.22 42.26 3.33
2579 3002 9.877137 TGCTTATTTCATAACAGCATATAAACG 57.123 29.630 0.00 0.00 0.00 3.60
3241 3790 8.467402 AACTTAATTGTCGATAACACTCTCTG 57.533 34.615 0.00 0.00 37.70 3.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 2.477245 TCCTATAGGGAACTGCTTGCA 58.523 47.619 18.97 0.0 43.88 4.08
900 1020 6.010650 ACAGGGCCCTCTTATCATATAGTCTA 60.011 42.308 25.77 0.0 0.00 2.59
976 1096 1.660167 TTAGCACTCTCGCTACGCTA 58.340 50.000 0.00 0.0 44.03 4.26
1269 1393 5.360714 TCTTGGAACTTCAGCAAAACAGAAT 59.639 36.000 0.00 0.0 0.00 2.40
1584 1708 0.533491 CTGCATGGGGTGAATGGTTG 59.467 55.000 0.00 0.0 0.00 3.77
1706 1830 5.001232 GTCATATGTATGTGGCCCGTTATT 58.999 41.667 0.00 0.0 35.26 1.40
1765 1889 2.697229 ACTCGCATTCATGAGATCCTCA 59.303 45.455 0.00 0.0 44.99 3.86
1847 1971 6.093219 TCAGTCATACTAGTGTTCTTCCGTAC 59.907 42.308 5.39 0.0 0.00 3.67
2435 2858 2.412065 GCAAAGCAGACAACGCTAGAAG 60.412 50.000 0.00 0.0 39.29 2.85
2508 2931 2.028748 ACTACACGTGCCCGATTAAAGT 60.029 45.455 17.22 2.7 37.88 2.66
2579 3002 7.536622 GGAAAATATGATCTTCGAATGTGATGC 59.463 37.037 0.00 0.0 0.00 3.91
2636 3059 6.660521 ACAAAGTGATCCAGCAAATAAGATCA 59.339 34.615 0.00 0.0 42.05 2.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.