Multiple sequence alignment - TraesCS3D01G053000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G053000 chr3D 100.000 2201 0 0 1 2201 21898696 21900896 0.000000e+00 4065
1 TraesCS3D01G053000 chr5D 97.747 2219 29 5 1 2201 6206683 6204468 0.000000e+00 3801
2 TraesCS3D01G053000 chr5D 99.074 2051 17 2 153 2201 240132461 240134511 0.000000e+00 3681
3 TraesCS3D01G053000 chr5D 99.118 1588 13 1 614 2201 449153933 449152347 0.000000e+00 2854
4 TraesCS3D01G053000 chr3B 97.565 2218 36 2 1 2201 201507718 201509934 0.000000e+00 3781
5 TraesCS3D01G053000 chr3B 95.745 188 7 1 264 451 386605063 386604877 3.550000e-78 302
6 TraesCS3D01G053000 chr4D 97.365 2201 43 7 1 2201 19911120 19913305 0.000000e+00 3729
7 TraesCS3D01G053000 chr2D 95.907 2248 43 6 1 2201 334227056 334229301 0.000000e+00 3596
8 TraesCS3D01G053000 chr1D 97.916 1919 17 15 1 1917 254490838 254492735 0.000000e+00 3301
9 TraesCS3D01G053000 chr1D 98.012 1710 16 2 1 1692 483921818 483920109 0.000000e+00 2953
10 TraesCS3D01G053000 chr1D 99.007 1410 12 1 794 2201 483919206 483917797 0.000000e+00 2525
11 TraesCS3D01G053000 chr1D 97.936 1308 7 3 1 1288 394180057 394181364 0.000000e+00 2248
12 TraesCS3D01G053000 chr1D 99.390 1148 6 1 1054 2201 254493672 254494818 0.000000e+00 2080
13 TraesCS3D01G053000 chr1D 98.847 954 11 0 1220 2173 254493682 254492729 0.000000e+00 1701
14 TraesCS3D01G053000 chrUn 98.090 1571 12 2 1 1553 317472046 317470476 0.000000e+00 2719
15 TraesCS3D01G053000 chr6D 97.794 1224 9 9 1 1206 431404047 431405270 0.000000e+00 2095
16 TraesCS3D01G053000 chr6D 97.412 1082 8 3 1 1062 431401166 431402247 0.000000e+00 1825
17 TraesCS3D01G053000 chr2A 98.423 1078 16 1 117 1194 588083887 588084963 0.000000e+00 1895
18 TraesCS3D01G053000 chr2B 98.997 299 3 0 1 299 759338845 759338547 8.940000e-149 536
19 TraesCS3D01G053000 chr3A 98.030 203 3 1 470 671 59774095 59774297 3.480000e-93 351
20 TraesCS3D01G053000 chr7B 97.159 176 3 2 1 175 262233623 262233449 1.650000e-76 296
21 TraesCS3D01G053000 chr7B 97.159 176 3 2 1 175 262234597 262234771 1.650000e-76 296


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G053000 chr3D 21898696 21900896 2200 False 4065.0 4065 100.0000 1 2201 1 chr3D.!!$F1 2200
1 TraesCS3D01G053000 chr5D 6204468 6206683 2215 True 3801.0 3801 97.7470 1 2201 1 chr5D.!!$R1 2200
2 TraesCS3D01G053000 chr5D 240132461 240134511 2050 False 3681.0 3681 99.0740 153 2201 1 chr5D.!!$F1 2048
3 TraesCS3D01G053000 chr5D 449152347 449153933 1586 True 2854.0 2854 99.1180 614 2201 1 chr5D.!!$R2 1587
4 TraesCS3D01G053000 chr3B 201507718 201509934 2216 False 3781.0 3781 97.5650 1 2201 1 chr3B.!!$F1 2200
5 TraesCS3D01G053000 chr4D 19911120 19913305 2185 False 3729.0 3729 97.3650 1 2201 1 chr4D.!!$F1 2200
6 TraesCS3D01G053000 chr2D 334227056 334229301 2245 False 3596.0 3596 95.9070 1 2201 1 chr2D.!!$F1 2200
7 TraesCS3D01G053000 chr1D 483917797 483921818 4021 True 2739.0 2953 98.5095 1 2201 2 chr1D.!!$R2 2200
8 TraesCS3D01G053000 chr1D 254490838 254494818 3980 False 2690.5 3301 98.6530 1 2201 2 chr1D.!!$F2 2200
9 TraesCS3D01G053000 chr1D 394180057 394181364 1307 False 2248.0 2248 97.9360 1 1288 1 chr1D.!!$F1 1287
10 TraesCS3D01G053000 chr1D 254492729 254493682 953 True 1701.0 1701 98.8470 1220 2173 1 chr1D.!!$R1 953
11 TraesCS3D01G053000 chrUn 317470476 317472046 1570 True 2719.0 2719 98.0900 1 1553 1 chrUn.!!$R1 1552
12 TraesCS3D01G053000 chr6D 431401166 431405270 4104 False 1960.0 2095 97.6030 1 1206 2 chr6D.!!$F1 1205
13 TraesCS3D01G053000 chr2A 588083887 588084963 1076 False 1895.0 1895 98.4230 117 1194 1 chr2A.!!$F1 1077

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
49 50 2.871453 ACCTGTGACATTTTGTACCCC 58.129 47.619 0.0 0.0 0.0 4.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2038 8607 3.362706 AGTGGTAGGAATCAACGAGCTA 58.637 45.455 0.0 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 2.871453 ACCTGTGACATTTTGTACCCC 58.129 47.619 0.0 0.0 0.0 4.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 1.394697 CTTGGTAGCGCGTTTGTTTG 58.605 50.000 8.43 0.00 0.00 2.93
423 475 8.474025 TGTTTTTATATCCCGCATTGAAAATCT 58.526 29.630 0.00 0.00 0.00 2.40
478 530 4.357018 GCTAAAGCACCAAACCATAGAC 57.643 45.455 0.00 0.00 41.59 2.59
1950 8519 4.840911 GAACTTAAGTTCCGGTTGTTGTC 58.159 43.478 30.17 8.16 46.42 3.18
2038 8607 3.362706 AGTGGTAGGAATCAACGAGCTA 58.637 45.455 0.00 0.00 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.