Multiple sequence alignment - TraesCS3D01G052900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G052900 chr3D 100.000 2096 0 0 1 2096 21896990 21899085 0.000000e+00 3871
1 TraesCS3D01G052900 chr1D 97.324 2130 19 10 1 2096 394178338 394180463 0.000000e+00 3583
2 TraesCS3D01G052900 chr1D 96.679 2108 29 18 1 2096 254489130 254491208 0.000000e+00 3467
3 TraesCS3D01G052900 chr1D 96.967 1187 8 6 932 2096 483922592 483921412 0.000000e+00 1967
4 TraesCS3D01G052900 chr6D 97.314 2122 23 8 1 2096 431399459 431401572 0.000000e+00 3572
5 TraesCS3D01G052900 chr6D 96.911 1036 9 3 1084 2096 431403702 431402667 0.000000e+00 1714
6 TraesCS3D01G052900 chr6D 96.850 762 5 8 1353 2096 431403693 431404453 0.000000e+00 1256
7 TraesCS3D01G052900 chrUn 97.180 2128 22 7 1 2096 317473761 317471640 0.000000e+00 3563
8 TraesCS3D01G052900 chr2A 96.963 2107 43 8 1 2096 335825714 335827810 0.000000e+00 3517
9 TraesCS3D01G052900 chr2A 98.905 274 2 1 1823 2096 588083887 588084159 2.420000e-134 488
10 TraesCS3D01G052900 chr3B 95.824 2131 47 8 1 2096 201506001 201508124 0.000000e+00 3404
11 TraesCS3D01G052900 chr5D 96.863 2040 30 8 80 2096 6208305 6206277 0.000000e+00 3382
12 TraesCS3D01G052900 chr5D 95.628 1418 34 7 1 1399 329132282 329130874 0.000000e+00 2250
13 TraesCS3D01G052900 chr5D 97.072 1332 15 4 743 2050 554200515 554201846 0.000000e+00 2222
14 TraesCS3D01G052900 chr5D 96.681 934 8 3 1185 2096 554197429 554198361 0.000000e+00 1531
15 TraesCS3D01G052900 chr2D 98.000 1500 14 4 1 1491 628285106 628286598 0.000000e+00 2590
16 TraesCS3D01G052900 chr1A 95.833 1056 25 5 1 1050 256026731 256025689 0.000000e+00 1688
17 TraesCS3D01G052900 chr7D 93.628 1130 48 4 1 1115 88605008 88606128 0.000000e+00 1666
18 TraesCS3D01G052900 chr5A 95.588 952 28 4 1 946 684325024 684325967 0.000000e+00 1513
19 TraesCS3D01G052900 chr7B 96.842 190 4 2 640 829 8175135 8175322 1.210000e-82 316
20 TraesCS3D01G052900 chr7B 96.316 190 4 2 640 829 8018236 8018422 2.020000e-80 309
21 TraesCS3D01G052900 chr2B 91.608 143 4 1 4 138 482853927 482854069 7.630000e-45 191


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G052900 chr3D 21896990 21899085 2095 False 3871.0 3871 100.0000 1 2096 1 chr3D.!!$F1 2095
1 TraesCS3D01G052900 chr1D 394178338 394180463 2125 False 3583.0 3583 97.3240 1 2096 1 chr1D.!!$F2 2095
2 TraesCS3D01G052900 chr1D 254489130 254491208 2078 False 3467.0 3467 96.6790 1 2096 1 chr1D.!!$F1 2095
3 TraesCS3D01G052900 chr1D 483921412 483922592 1180 True 1967.0 1967 96.9670 932 2096 1 chr1D.!!$R1 1164
4 TraesCS3D01G052900 chr6D 431399459 431404453 4994 False 2414.0 3572 97.0820 1 2096 2 chr6D.!!$F1 2095
5 TraesCS3D01G052900 chr6D 431402667 431403702 1035 True 1714.0 1714 96.9110 1084 2096 1 chr6D.!!$R1 1012
6 TraesCS3D01G052900 chrUn 317471640 317473761 2121 True 3563.0 3563 97.1800 1 2096 1 chrUn.!!$R1 2095
7 TraesCS3D01G052900 chr2A 335825714 335827810 2096 False 3517.0 3517 96.9630 1 2096 1 chr2A.!!$F1 2095
8 TraesCS3D01G052900 chr3B 201506001 201508124 2123 False 3404.0 3404 95.8240 1 2096 1 chr3B.!!$F1 2095
9 TraesCS3D01G052900 chr5D 6206277 6208305 2028 True 3382.0 3382 96.8630 80 2096 1 chr5D.!!$R1 2016
10 TraesCS3D01G052900 chr5D 329130874 329132282 1408 True 2250.0 2250 95.6280 1 1399 1 chr5D.!!$R2 1398
11 TraesCS3D01G052900 chr5D 554197429 554201846 4417 False 1876.5 2222 96.8765 743 2096 2 chr5D.!!$F1 1353
12 TraesCS3D01G052900 chr2D 628285106 628286598 1492 False 2590.0 2590 98.0000 1 1491 1 chr2D.!!$F1 1490
13 TraesCS3D01G052900 chr1A 256025689 256026731 1042 True 1688.0 1688 95.8330 1 1050 1 chr1A.!!$R1 1049
14 TraesCS3D01G052900 chr7D 88605008 88606128 1120 False 1666.0 1666 93.6280 1 1115 1 chr7D.!!$F1 1114
15 TraesCS3D01G052900 chr5A 684325024 684325967 943 False 1513.0 1513 95.5880 1 946 1 chr5A.!!$F1 945

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
50 51 1.028905 TTTGCCTGGTTCCGAAACAG 58.971 50.0 17.9 17.9 37.1 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1399 6639 0.461961 GGTCTGGAGGAGGTCAATCG 59.538 60.0 0.0 0.0 0.0 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 1.028905 TTTGCCTGGTTCCGAAACAG 58.971 50.000 17.90 17.9 37.10 3.16
801 3146 9.311916 CTTTACTCAATTGACAAATTCCACAAA 57.688 29.630 3.38 0.0 33.59 2.83
841 3186 8.523658 CGAAATTAGGGACTCATGTATCATCTA 58.476 37.037 0.00 0.0 41.75 1.98
1203 3553 6.210185 AGGAATTCTTTTCTTGGTCATTGAGG 59.790 38.462 5.23 0.0 0.00 3.86
1294 3650 7.421530 TCGAATGAAGTTTTTCTACTTGGAG 57.578 36.000 0.00 0.0 38.43 3.86
1755 6997 2.871453 ACCTGTGACATTTTGTACCCC 58.129 47.619 0.00 0.0 0.00 4.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
93 133 5.410924 GGGTTTTCTATTGATGCCTTGAAC 58.589 41.667 0.00 0.00 0.0 3.18
313 355 9.747898 TTAGACCTAATCCAACAAACAATACAT 57.252 29.630 0.00 0.00 0.0 2.29
801 3146 8.678199 GTCCCTAATTTCGAATCAAGAGATTTT 58.322 33.333 0.00 0.00 44.3 1.82
841 3186 9.136323 AGAAGTGTAAAAGAAAGTGGATTCATT 57.864 29.630 0.00 0.00 0.0 2.57
1288 3644 1.187087 AGGCCTAAGACGACTCCAAG 58.813 55.000 1.29 0.00 0.0 3.61
1294 3650 5.725325 ATAGGAATTAGGCCTAAGACGAC 57.275 43.478 28.35 16.63 41.1 4.34
1399 6639 0.461961 GGTCTGGAGGAGGTCAATCG 59.538 60.000 0.00 0.00 0.0 3.34
1657 6899 7.063074 CGACGAGATCAATTAAAGTAAAGTGGT 59.937 37.037 0.00 0.00 0.0 4.16
1755 6997 1.394697 CTTGGTAGCGCGTTTGTTTG 58.605 50.000 8.43 0.00 0.0 2.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.