Multiple sequence alignment - TraesCS3D01G052800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G052800 chr3D 100.000 2252 0 0 1 2252 21897838 21895587 0.000000e+00 4159
1 TraesCS3D01G052800 chr2D 98.406 2259 22 5 1 2252 628285951 628283700 0.000000e+00 3960
2 TraesCS3D01G052800 chr6D 98.318 2259 29 7 1 2252 431400309 431398053 0.000000e+00 3952
3 TraesCS3D01G052800 chr1D 98.186 2260 32 5 1 2252 254489984 254487726 0.000000e+00 3938
4 TraesCS3D01G052800 chr1D 95.610 1754 63 9 502 2252 244408395 244406653 0.000000e+00 2800
5 TraesCS3D01G052800 chr1D 95.382 1754 66 9 502 2252 244401944 244400203 0.000000e+00 2776
6 TraesCS3D01G052800 chr1D 94.644 1755 79 8 502 2252 244423932 244422189 0.000000e+00 2706
7 TraesCS3D01G052800 chr5D 96.703 2275 46 10 1 2252 329131423 329133691 0.000000e+00 3759
8 TraesCS3D01G052800 chr5D 97.665 771 14 3 1 770 6207538 6208305 0.000000e+00 1321
9 TraesCS3D01G052800 chr2A 96.634 2258 62 6 1 2252 335826562 335824313 0.000000e+00 3736
10 TraesCS3D01G052800 chr2A 96.339 2267 66 7 1 2252 276440792 276443056 0.000000e+00 3711
11 TraesCS3D01G052800 chr5A 96.150 2260 58 12 1 2252 684325870 684323632 0.000000e+00 3664
12 TraesCS3D01G052800 chr1A 97.447 2154 39 7 1 2147 256025884 256028028 0.000000e+00 3659
13 TraesCS3D01G052800 chrUn 97.984 992 12 3 1 984 317472905 317473896 0.000000e+00 1714
14 TraesCS3D01G052800 chr7B 96.842 190 4 2 21 210 8175322 8175135 1.300000e-82 316
15 TraesCS3D01G052800 chr7B 96.316 190 4 2 21 210 8018422 8018236 2.170000e-80 309


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G052800 chr3D 21895587 21897838 2251 True 4159 4159 100.000 1 2252 1 chr3D.!!$R1 2251
1 TraesCS3D01G052800 chr2D 628283700 628285951 2251 True 3960 3960 98.406 1 2252 1 chr2D.!!$R1 2251
2 TraesCS3D01G052800 chr6D 431398053 431400309 2256 True 3952 3952 98.318 1 2252 1 chr6D.!!$R1 2251
3 TraesCS3D01G052800 chr1D 254487726 254489984 2258 True 3938 3938 98.186 1 2252 1 chr1D.!!$R4 2251
4 TraesCS3D01G052800 chr1D 244406653 244408395 1742 True 2800 2800 95.610 502 2252 1 chr1D.!!$R2 1750
5 TraesCS3D01G052800 chr1D 244400203 244401944 1741 True 2776 2776 95.382 502 2252 1 chr1D.!!$R1 1750
6 TraesCS3D01G052800 chr1D 244422189 244423932 1743 True 2706 2706 94.644 502 2252 1 chr1D.!!$R3 1750
7 TraesCS3D01G052800 chr5D 329131423 329133691 2268 False 3759 3759 96.703 1 2252 1 chr5D.!!$F2 2251
8 TraesCS3D01G052800 chr5D 6207538 6208305 767 False 1321 1321 97.665 1 770 1 chr5D.!!$F1 769
9 TraesCS3D01G052800 chr2A 335824313 335826562 2249 True 3736 3736 96.634 1 2252 1 chr2A.!!$R1 2251
10 TraesCS3D01G052800 chr2A 276440792 276443056 2264 False 3711 3711 96.339 1 2252 1 chr2A.!!$F1 2251
11 TraesCS3D01G052800 chr5A 684323632 684325870 2238 True 3664 3664 96.150 1 2252 1 chr5A.!!$R1 2251
12 TraesCS3D01G052800 chr1A 256025884 256028028 2144 False 3659 3659 97.447 1 2147 1 chr1A.!!$F1 2146
13 TraesCS3D01G052800 chrUn 317472905 317473896 991 False 1714 1714 97.984 1 984 1 chrUn.!!$F1 983

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
827 861 2.380064 ACCAGGCAAAACCAGATTGA 57.62 45.0 0.0 0.0 43.14 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2219 2284 1.822371 GGTCTGTCTCTTGGACCTCTC 59.178 57.143 0.0 0.0 44.21 3.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 8.678199 GTCCCTAATTTCGAATCAAGAGATTTT 58.322 33.333 0.00 0.00 44.30 1.82
535 546 9.747898 TTAGACCTAATCCAACAAACAATACAT 57.252 29.630 0.00 0.00 0.00 2.29
755 768 5.410924 GGGTTTTCTATTGATGCCTTGAAC 58.589 41.667 0.00 0.00 0.00 3.18
827 861 2.380064 ACCAGGCAAAACCAGATTGA 57.620 45.000 0.00 0.00 43.14 2.57
954 988 3.517901 ACTGGTCGATCCCATCTTTTACA 59.482 43.478 0.00 0.00 33.00 2.41
1021 1055 0.250513 GTCTGGAAGCACGGGAGAAT 59.749 55.000 0.00 0.00 0.00 2.40
1697 1746 4.448720 TGGCTGATAGGTACTGTAGCTA 57.551 45.455 24.11 24.11 41.52 3.32
1984 2040 6.685527 GGAAGTATCCTGAAAATCCTTGAC 57.314 41.667 0.00 0.00 42.93 3.18
2219 2284 6.848451 TCGGCTAAACCTAAGCAAAATAAAG 58.152 36.000 0.00 0.00 41.93 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 8.523658 CGAAATTAGGGACTCATGTATCATCTA 58.476 37.037 0.00 0.00 41.75 1.98
47 48 9.311916 CTTTACTCAATTGACAAATTCCACAAA 57.688 29.630 3.38 0.00 33.59 2.83
798 832 1.028905 TTTGCCTGGTTCCGAAACAG 58.971 50.000 17.90 17.90 37.10 3.16
1021 1055 7.093814 ACTGGCAATAATATCAGCAAAAGAACA 60.094 33.333 0.00 0.00 0.00 3.18
1350 1399 5.361571 TGGATGAACTGCATTGCTGATATTT 59.638 36.000 20.66 5.78 37.34 1.40
1697 1746 5.228945 ACTAAACCAATCACAGCAGTACT 57.771 39.130 0.00 0.00 0.00 2.73
1701 1750 4.393062 CACCTACTAAACCAATCACAGCAG 59.607 45.833 0.00 0.00 0.00 4.24
2219 2284 1.822371 GGTCTGTCTCTTGGACCTCTC 59.178 57.143 0.00 0.00 44.21 3.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.