Multiple sequence alignment - TraesCS3D01G052700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G052700 chr3D 100.000 2117 0 0 1 2117 21897434 21895318 0 3910
1 TraesCS3D01G052700 chr2D 98.350 2121 24 4 1 2117 628285544 628283431 0 3712
2 TraesCS3D01G052700 chr6D 98.209 2122 29 5 1 2117 431399905 431397788 0 3699
3 TraesCS3D01G052700 chr1D 98.160 2120 36 3 1 2117 254489576 254487457 0 3696
4 TraesCS3D01G052700 chr1D 95.502 2023 75 10 98 2117 244408395 244406386 0 3217
5 TraesCS3D01G052700 chr1D 95.255 2023 80 10 98 2117 244401944 244399935 0 3190
6 TraesCS3D01G052700 chr1D 94.423 2026 94 10 98 2117 244423932 244421920 0 3097
7 TraesCS3D01G052700 chr2A 96.945 2128 53 6 1 2117 276441198 276443324 0 3559
8 TraesCS3D01G052700 chr2A 96.982 1988 52 4 1 1987 335826154 335824174 0 3332
9 TraesCS3D01G052700 chr5A 96.698 2120 48 10 1 2117 684325463 684323363 0 3507
10 TraesCS3D01G052700 chr1A 98.052 1745 24 5 1 1743 256026292 256028028 0 3025


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G052700 chr3D 21895318 21897434 2116 True 3910 3910 100.000 1 2117 1 chr3D.!!$R1 2116
1 TraesCS3D01G052700 chr2D 628283431 628285544 2113 True 3712 3712 98.350 1 2117 1 chr2D.!!$R1 2116
2 TraesCS3D01G052700 chr6D 431397788 431399905 2117 True 3699 3699 98.209 1 2117 1 chr6D.!!$R1 2116
3 TraesCS3D01G052700 chr1D 254487457 254489576 2119 True 3696 3696 98.160 1 2117 1 chr1D.!!$R4 2116
4 TraesCS3D01G052700 chr1D 244406386 244408395 2009 True 3217 3217 95.502 98 2117 1 chr1D.!!$R2 2019
5 TraesCS3D01G052700 chr1D 244399935 244401944 2009 True 3190 3190 95.255 98 2117 1 chr1D.!!$R1 2019
6 TraesCS3D01G052700 chr1D 244421920 244423932 2012 True 3097 3097 94.423 98 2117 1 chr1D.!!$R3 2019
7 TraesCS3D01G052700 chr2A 276441198 276443324 2126 False 3559 3559 96.945 1 2117 1 chr2A.!!$F1 2116
8 TraesCS3D01G052700 chr2A 335824174 335826154 1980 True 3332 3332 96.982 1 1987 1 chr2A.!!$R1 1986
9 TraesCS3D01G052700 chr5A 684323363 684325463 2100 True 3507 3507 96.698 1 2117 1 chr5A.!!$R1 2116
10 TraesCS3D01G052700 chr1A 256026292 256028028 1736 False 3025 3025 98.052 1 1743 1 chr1A.!!$F1 1742

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
617 634 0.250513 GTCTGGAAGCACGGGAGAAT 59.749 55.0 0.0 0.0 0.0 2.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1815 1852 1.822371 GGTCTGTCTCTTGGACCTCTC 59.178 57.143 0.0 0.0 44.21 3.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
131 132 9.747898 TTAGACCTAATCCAACAAACAATACAT 57.252 29.630 0.00 0.00 0.00 2.29
351 354 5.410924 GGGTTTTCTATTGATGCCTTGAAC 58.589 41.667 0.00 0.00 0.00 3.18
423 440 2.380064 ACCAGGCAAAACCAGATTGA 57.620 45.000 0.00 0.00 43.14 2.57
550 567 3.517901 ACTGGTCGATCCCATCTTTTACA 59.482 43.478 0.00 0.00 33.00 2.41
617 634 0.250513 GTCTGGAAGCACGGGAGAAT 59.749 55.000 0.00 0.00 0.00 2.40
1293 1324 4.448720 TGGCTGATAGGTACTGTAGCTA 57.551 45.455 24.11 24.11 41.52 3.32
1580 1611 6.685527 GGAAGTATCCTGAAAATCCTTGAC 57.314 41.667 0.00 0.00 42.93 3.18
1815 1852 6.848451 TCGGCTAAACCTAAGCAAAATAAAG 58.152 36.000 0.00 0.00 41.93 1.85
2019 2056 1.280710 TCTCGCCTTTGCCTTGGATTA 59.719 47.619 0.00 0.00 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
394 411 1.028905 TTTGCCTGGTTCCGAAACAG 58.971 50.000 17.90 17.90 37.10 3.16
617 634 7.093814 ACTGGCAATAATATCAGCAAAAGAACA 60.094 33.333 0.00 0.00 0.00 3.18
946 977 5.361571 TGGATGAACTGCATTGCTGATATTT 59.638 36.000 20.66 5.78 37.34 1.40
1293 1324 5.228945 ACTAAACCAATCACAGCAGTACT 57.771 39.130 0.00 0.00 0.00 2.73
1297 1328 4.393062 CACCTACTAAACCAATCACAGCAG 59.607 45.833 0.00 0.00 0.00 4.24
1815 1852 1.822371 GGTCTGTCTCTTGGACCTCTC 59.178 57.143 0.00 0.00 44.21 3.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.