Multiple sequence alignment - TraesCS3D01G052500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G052500 chr3D 100.000 3217 0 0 1 3217 21893039 21896255 0.000000e+00 5904.0
1 TraesCS3D01G052500 chr3B 98.601 1716 19 4 1 1714 201502305 201504017 0.000000e+00 3031.0
2 TraesCS3D01G052500 chr3B 98.303 1650 22 4 1 1646 10274477 10276124 0.000000e+00 2887.0
3 TraesCS3D01G052500 chr3B 96.865 1499 30 7 1725 3217 201503778 201505265 0.000000e+00 2492.0
4 TraesCS3D01G052500 chr3B 92.241 1495 77 16 1725 3202 460161189 460159717 0.000000e+00 2082.0
5 TraesCS3D01G052500 chr1A 98.427 1716 23 3 1 1714 554469298 554467585 0.000000e+00 3016.0
6 TraesCS3D01G052500 chr1A 97.332 1499 25 5 1725 3217 554467824 554466335 0.000000e+00 2532.0
7 TraesCS3D01G052500 chr5D 98.254 1718 22 7 1 1714 483799826 483798113 0.000000e+00 3000.0
8 TraesCS3D01G052500 chr5D 97.786 1716 32 5 1 1714 6211915 6210204 0.000000e+00 2953.0
9 TraesCS3D01G052500 chr1B 98.077 1716 28 4 1 1714 633724798 633726510 0.000000e+00 2981.0
10 TraesCS3D01G052500 chr1D 95.105 1716 64 14 1 1714 244419924 244421621 0.000000e+00 2686.0
11 TraesCS3D01G052500 chr1D 94.933 1717 64 15 1 1714 244404392 244406088 0.000000e+00 2667.0
12 TraesCS3D01G052500 chr1D 96.386 1494 28 4 1725 3217 254486927 254488395 0.000000e+00 2436.0
13 TraesCS3D01G052500 chr1D 94.311 1494 51 13 1725 3217 244405857 244407317 0.000000e+00 2257.0
14 TraesCS3D01G052500 chr5A 97.860 1495 29 3 1725 3217 684322809 684324302 0.000000e+00 2580.0
15 TraesCS3D01G052500 chr7A 92.561 1734 94 16 1 1714 707548882 707547164 0.000000e+00 2455.0
16 TraesCS3D01G052500 chr7A 92.616 1720 87 21 1 1714 710800099 710801784 0.000000e+00 2436.0
17 TraesCS3D01G052500 chr7A 94.531 256 7 3 1725 1979 707517524 707517275 3.890000e-104 388.0
18 TraesCS3D01G052500 chr7A 91.791 268 9 3 1725 1979 707547420 707547153 8.480000e-96 361.0
19 TraesCS3D01G052500 chr7A 91.085 258 7 7 1725 1979 710801551 710801795 5.140000e-88 335.0
20 TraesCS3D01G052500 chr2A 97.461 1418 27 5 1803 3217 276443796 276442385 0.000000e+00 2410.0
21 TraesCS3D01G052500 chr2A 97.917 480 4 3 1800 2278 588082865 588083339 0.000000e+00 826.0
22 TraesCS3D01G052500 chr2A 86.154 260 29 3 1987 2240 747298103 747297845 1.140000e-69 274.0
23 TraesCS3D01G052500 chr2D 98.423 1332 14 4 1889 3217 628283044 628284371 0.000000e+00 2337.0
24 TraesCS3D01G052500 chr2D 98.525 1017 12 1 2204 3217 628286609 628287625 0.000000e+00 1792.0
25 TraesCS3D01G052500 chr6D 98.016 1109 15 3 2112 3217 431397620 431398724 0.000000e+00 1919.0
26 TraesCS3D01G052500 chr2B 100.000 29 0 0 3189 3217 166210904 166210876 2.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G052500 chr3D 21893039 21896255 3216 False 5904.0 5904 100.0000 1 3217 1 chr3D.!!$F1 3216
1 TraesCS3D01G052500 chr3B 10274477 10276124 1647 False 2887.0 2887 98.3030 1 1646 1 chr3B.!!$F1 1645
2 TraesCS3D01G052500 chr3B 201502305 201505265 2960 False 2761.5 3031 97.7330 1 3217 2 chr3B.!!$F2 3216
3 TraesCS3D01G052500 chr3B 460159717 460161189 1472 True 2082.0 2082 92.2410 1725 3202 1 chr3B.!!$R1 1477
4 TraesCS3D01G052500 chr1A 554466335 554469298 2963 True 2774.0 3016 97.8795 1 3217 2 chr1A.!!$R1 3216
5 TraesCS3D01G052500 chr5D 483798113 483799826 1713 True 3000.0 3000 98.2540 1 1714 1 chr5D.!!$R2 1713
6 TraesCS3D01G052500 chr5D 6210204 6211915 1711 True 2953.0 2953 97.7860 1 1714 1 chr5D.!!$R1 1713
7 TraesCS3D01G052500 chr1B 633724798 633726510 1712 False 2981.0 2981 98.0770 1 1714 1 chr1B.!!$F1 1713
8 TraesCS3D01G052500 chr1D 244419924 244421621 1697 False 2686.0 2686 95.1050 1 1714 1 chr1D.!!$F1 1713
9 TraesCS3D01G052500 chr1D 244404392 244407317 2925 False 2462.0 2667 94.6220 1 3217 2 chr1D.!!$F3 3216
10 TraesCS3D01G052500 chr1D 254486927 254488395 1468 False 2436.0 2436 96.3860 1725 3217 1 chr1D.!!$F2 1492
11 TraesCS3D01G052500 chr5A 684322809 684324302 1493 False 2580.0 2580 97.8600 1725 3217 1 chr5A.!!$F1 1492
12 TraesCS3D01G052500 chr7A 707547153 707548882 1729 True 1408.0 2455 92.1760 1 1979 2 chr7A.!!$R2 1978
13 TraesCS3D01G052500 chr7A 710800099 710801795 1696 False 1385.5 2436 91.8505 1 1979 2 chr7A.!!$F1 1978
14 TraesCS3D01G052500 chr2A 276442385 276443796 1411 True 2410.0 2410 97.4610 1803 3217 1 chr2A.!!$R1 1414
15 TraesCS3D01G052500 chr2D 628283044 628287625 4581 False 2064.5 2337 98.4740 1889 3217 2 chr2D.!!$F1 1328
16 TraesCS3D01G052500 chr6D 431397620 431398724 1104 False 1919.0 1919 98.0160 2112 3217 1 chr6D.!!$F1 1105

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
407 419 5.247507 TCTCCATACCATTTTGCATTTCG 57.752 39.13 0.0 0.0 0.0 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2376 2421 1.28071 TCTCGCCTTTGCCTTGGATTA 59.719 47.619 0.0 0.0 0.0 1.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
407 419 5.247507 TCTCCATACCATTTTGCATTTCG 57.752 39.130 0.00 0.0 0.00 3.46
425 437 6.085458 GCATTTCGCGACAAATATAATCTGTG 59.915 38.462 9.15 0.0 0.00 3.66
856 874 6.013812 AGCCCTGTTCCATTTTAGCAAAATTA 60.014 34.615 4.70 0.0 38.97 1.40
1154 1173 0.468226 AACCCACGAGAAGCAACTGA 59.532 50.000 0.00 0.0 0.00 3.41
1156 1175 1.072331 ACCCACGAGAAGCAACTGAAT 59.928 47.619 0.00 0.0 0.00 2.57
1335 1355 7.816640 TGAATGTAGGTGCTGTTCTTATTTTC 58.183 34.615 0.00 0.0 0.00 2.29
1367 1387 3.454587 AATTAGCGCCGCCCGATCA 62.455 57.895 4.98 0.0 40.02 2.92
2580 2625 1.822371 GGTCTGTCTCTTGGACCTCTC 59.178 57.143 0.00 0.0 44.21 3.20
2584 2629 4.767928 GTCTGTCTCTTGGACCTCTCTTTA 59.232 45.833 0.00 0.0 43.89 1.85
3098 6421 4.393062 CACCTACTAAACCAATCACAGCAG 59.607 45.833 0.00 0.0 0.00 4.24
3102 6425 5.228945 ACTAAACCAATCACAGCAGTACT 57.771 39.130 0.00 0.0 0.00 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
258 269 9.930693 GTCCAAGAGAGAAAGTTCTTCTAATTA 57.069 33.333 0.00 0.00 37.73 1.40
335 347 9.748708 CCATTGTATTATTTCCTTGTGTATTGG 57.251 33.333 0.00 0.00 0.00 3.16
336 348 9.748708 CCCATTGTATTATTTCCTTGTGTATTG 57.251 33.333 0.00 0.00 0.00 1.90
407 419 4.273480 AGCCACACAGATTATATTTGTCGC 59.727 41.667 0.00 0.00 0.00 5.19
425 437 6.819397 AAAAGAACCACTTAGAATAGCCAC 57.181 37.500 0.00 0.00 37.93 5.01
466 478 6.729690 ACCCAAGAATTCAAAATGACAAGA 57.270 33.333 8.44 0.00 0.00 3.02
1086 1104 8.481492 TGGGATATGCATTTGAAATAGATGTT 57.519 30.769 3.54 0.00 0.00 2.71
1154 1173 4.877251 GGCAATTGGCACATACAATTCATT 59.123 37.500 25.76 0.00 44.29 2.57
1156 1175 3.260128 TGGCAATTGGCACATACAATTCA 59.740 39.130 29.00 3.40 44.29 2.57
1367 1387 9.822727 TCTTTTCTTTTAACTCAGGGGAAATAT 57.177 29.630 0.00 0.00 0.00 1.28
2376 2421 1.280710 TCTCGCCTTTGCCTTGGATTA 59.719 47.619 0.00 0.00 0.00 1.75
2580 2625 6.848451 TCGGCTAAACCTAAGCAAAATAAAG 58.152 36.000 0.00 0.00 41.93 1.85
2584 2629 3.694566 CCTCGGCTAAACCTAAGCAAAAT 59.305 43.478 0.00 0.00 41.93 1.82
2815 2875 6.685527 GGAAGTATCCTGAAAATCCTTGAC 57.314 41.667 0.00 0.00 42.93 3.18
3102 6425 4.448720 TGGCTGATAGGTACTGTAGCTA 57.551 45.455 24.11 24.11 41.52 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.