Multiple sequence alignment - TraesCS3D01G046500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G046500 chr3D 100.000 2549 0 0 1 2549 17579352 17576804 0.000000e+00 4708.0
1 TraesCS3D01G046500 chr3D 99.881 1674 1 1 877 2549 17558444 17560117 0.000000e+00 3079.0
2 TraesCS3D01G046500 chr3D 94.553 2001 83 7 552 2549 410899595 410901572 0.000000e+00 3068.0
3 TraesCS3D01G046500 chrUn 95.710 2028 44 9 547 2549 93726515 93724506 0.000000e+00 3223.0
4 TraesCS3D01G046500 chrUn 100.000 1673 0 0 877 2549 368600928 368602600 0.000000e+00 3090.0
5 TraesCS3D01G046500 chr2D 94.627 2010 85 19 551 2549 647705357 647707354 0.000000e+00 3092.0
6 TraesCS3D01G046500 chr2D 93.606 2002 77 18 552 2549 547242743 547240789 0.000000e+00 2940.0
7 TraesCS3D01G046500 chr2D 87.307 583 35 21 1 551 274430683 274430108 4.630000e-177 630.0
8 TraesCS3D01G046500 chr5D 94.330 2046 65 11 548 2548 482332208 482330169 0.000000e+00 3088.0
9 TraesCS3D01G046500 chr3A 94.006 2002 92 11 552 2549 696312540 696310563 0.000000e+00 3007.0
10 TraesCS3D01G046500 chr3A 90.400 250 14 3 2301 2549 235189170 235189410 1.140000e-83 320.0
11 TraesCS3D01G046500 chr1A 93.956 2002 88 11 552 2549 71245439 71243467 0.000000e+00 2996.0
12 TraesCS3D01G046500 chr2A 93.353 2001 101 13 552 2549 659814582 659816553 0.000000e+00 2929.0
13 TraesCS3D01G046500 chr2A 91.139 395 31 2 551 942 60140642 60140249 1.340000e-147 532.0
14 TraesCS3D01G046500 chr2A 92.013 313 14 7 214 524 28673425 28673728 1.810000e-116 429.0
15 TraesCS3D01G046500 chr2A 97.059 34 1 0 518 551 28673960 28673993 9.850000e-05 58.4
16 TraesCS3D01G046500 chr6A 94.232 1907 82 12 544 2445 533982331 533980448 0.000000e+00 2887.0
17 TraesCS3D01G046500 chr6A 93.895 344 12 7 214 551 56066862 56067202 6.290000e-141 510.0
18 TraesCS3D01G046500 chr6A 94.444 54 3 0 166 219 56066784 56066837 1.630000e-12 84.2
19 TraesCS3D01G046500 chr7D 97.305 334 9 0 550 883 63995388 63995721 3.680000e-158 568.0
20 TraesCS3D01G046500 chr7A 92.443 397 24 2 552 942 30966346 30966742 1.710000e-156 562.0
21 TraesCS3D01G046500 chr4D 92.138 407 19 2 536 942 50776919 50777312 1.710000e-156 562.0
22 TraesCS3D01G046500 chr3B 85.688 545 42 17 39 551 79038237 79037697 2.230000e-150 542.0
23 TraesCS3D01G046500 chr2B 91.457 398 27 3 551 944 19091946 19092340 8.020000e-150 540.0
24 TraesCS3D01G046500 chr2B 90.148 406 33 3 544 942 71201265 71200860 2.910000e-144 521.0
25 TraesCS3D01G046500 chr2B 94.048 336 15 4 217 551 785802808 785802477 2.930000e-139 505.0
26 TraesCS3D01G046500 chr2B 89.209 139 12 3 83 219 785802973 785802836 1.210000e-38 171.0
27 TraesCS3D01G046500 chr6D 93.433 335 11 4 217 551 422352696 422352373 1.060000e-133 486.0
28 TraesCS3D01G046500 chr6D 95.413 218 7 3 2 219 422352938 422352724 6.750000e-91 344.0
29 TraesCS3D01G046500 chr4B 93.458 321 16 5 214 532 450108615 450108932 2.970000e-129 472.0
30 TraesCS3D01G046500 chr4B 93.182 220 10 4 1 219 450108375 450108590 4.090000e-83 318.0
31 TraesCS3D01G046500 chr4B 97.297 37 1 0 515 551 450108947 450108983 2.120000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G046500 chr3D 17576804 17579352 2548 True 4708.000000 4708 100.000000 1 2549 1 chr3D.!!$R1 2548
1 TraesCS3D01G046500 chr3D 17558444 17560117 1673 False 3079.000000 3079 99.881000 877 2549 1 chr3D.!!$F1 1672
2 TraesCS3D01G046500 chr3D 410899595 410901572 1977 False 3068.000000 3068 94.553000 552 2549 1 chr3D.!!$F2 1997
3 TraesCS3D01G046500 chrUn 93724506 93726515 2009 True 3223.000000 3223 95.710000 547 2549 1 chrUn.!!$R1 2002
4 TraesCS3D01G046500 chrUn 368600928 368602600 1672 False 3090.000000 3090 100.000000 877 2549 1 chrUn.!!$F1 1672
5 TraesCS3D01G046500 chr2D 647705357 647707354 1997 False 3092.000000 3092 94.627000 551 2549 1 chr2D.!!$F1 1998
6 TraesCS3D01G046500 chr2D 547240789 547242743 1954 True 2940.000000 2940 93.606000 552 2549 1 chr2D.!!$R2 1997
7 TraesCS3D01G046500 chr2D 274430108 274430683 575 True 630.000000 630 87.307000 1 551 1 chr2D.!!$R1 550
8 TraesCS3D01G046500 chr5D 482330169 482332208 2039 True 3088.000000 3088 94.330000 548 2548 1 chr5D.!!$R1 2000
9 TraesCS3D01G046500 chr3A 696310563 696312540 1977 True 3007.000000 3007 94.006000 552 2549 1 chr3A.!!$R1 1997
10 TraesCS3D01G046500 chr1A 71243467 71245439 1972 True 2996.000000 2996 93.956000 552 2549 1 chr1A.!!$R1 1997
11 TraesCS3D01G046500 chr2A 659814582 659816553 1971 False 2929.000000 2929 93.353000 552 2549 1 chr2A.!!$F1 1997
12 TraesCS3D01G046500 chr2A 28673425 28673993 568 False 243.700000 429 94.536000 214 551 2 chr2A.!!$F2 337
13 TraesCS3D01G046500 chr6A 533980448 533982331 1883 True 2887.000000 2887 94.232000 544 2445 1 chr6A.!!$R1 1901
14 TraesCS3D01G046500 chr3B 79037697 79038237 540 True 542.000000 542 85.688000 39 551 1 chr3B.!!$R1 512
15 TraesCS3D01G046500 chr6D 422352373 422352938 565 True 415.000000 486 94.423000 2 551 2 chr6D.!!$R1 549
16 TraesCS3D01G046500 chr4B 450108375 450108983 608 False 284.633333 472 94.645667 1 551 3 chr4B.!!$F1 550

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
886 1232 0.179084 ACGGCGAGAGAGAGAGAGAG 60.179 60.0 16.62 0.0 0.0 3.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1909 2296 9.241919 TCTGGAATAATTCAATTAGCTTTCACA 57.758 29.63 0.0 0.0 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.541233 CGGGCATCAATACTCCTGGTC 60.541 57.143 0.00 0.00 0.00 4.02
94 95 7.947782 ATACTCCTGGTCCCAGAAATATTTA 57.052 36.000 14.98 0.00 46.30 1.40
96 97 5.104067 ACTCCTGGTCCCAGAAATATTTACC 60.104 44.000 14.98 5.47 46.30 2.85
453 489 2.890808 TTAGGCAAGCATCTACTCGG 57.109 50.000 0.00 0.00 0.00 4.63
613 921 0.881118 TTTTGCCCTCAGATGCGAAC 59.119 50.000 0.00 0.00 30.78 3.95
665 973 0.728466 CGACTCGTTCCGTGAACTCC 60.728 60.000 12.80 2.11 40.05 3.85
673 981 2.049433 CGTGAACTCCGCCGTCTT 60.049 61.111 0.00 0.00 0.00 3.01
689 997 2.985139 CGTCTTCGTTAGGTCAACCTTC 59.015 50.000 7.07 0.97 46.09 3.46
885 1231 0.461163 CACGGCGAGAGAGAGAGAGA 60.461 60.000 16.62 0.00 0.00 3.10
886 1232 0.179084 ACGGCGAGAGAGAGAGAGAG 60.179 60.000 16.62 0.00 0.00 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 133 6.500684 ACCAGTTTAGTAAACATGCAGATG 57.499 37.500 24.09 13.16 43.79 2.90
164 166 9.737844 ATTTTTACACATGCCCTATTTTTGATT 57.262 25.926 0.00 0.00 0.00 2.57
265 298 4.700213 GGGTGTTCTCTAGCATAGCAAAAA 59.300 41.667 0.00 0.00 38.99 1.94
434 470 2.108168 ACCGAGTAGATGCTTGCCTAA 58.892 47.619 0.00 0.00 0.00 2.69
453 489 7.258441 TGCATACAGTGATTAGTCTGTCTAAC 58.742 38.462 0.00 0.00 42.77 2.34
630 938 4.111016 CGGTGCGCACGGACTAGA 62.111 66.667 36.33 0.00 36.67 2.43
665 973 0.387622 TTGACCTAACGAAGACGGCG 60.388 55.000 4.80 4.80 44.46 6.46
729 1037 4.520874 TGCAACGGTCTGAATAAAATTGGA 59.479 37.500 0.00 0.00 0.00 3.53
885 1231 3.133721 GTGCTCTCTCTCTCTCTCTCTCT 59.866 52.174 0.00 0.00 0.00 3.10
886 1232 3.462021 GTGCTCTCTCTCTCTCTCTCTC 58.538 54.545 0.00 0.00 0.00 3.20
1909 2296 9.241919 TCTGGAATAATTCAATTAGCTTTCACA 57.758 29.630 0.00 0.00 0.00 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.