Multiple sequence alignment - TraesCS3D01G029900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G029900 chr3D 100.000 2993 0 0 1 2993 10803087 10806079 0.000000e+00 5528
1 TraesCS3D01G029900 chr3D 100.000 718 0 0 2276 2993 10818689 10819406 0.000000e+00 1327
2 TraesCS3D01G029900 chr3A 96.246 2264 47 16 4 2254 17453953 17451715 0.000000e+00 3675
3 TraesCS3D01G029900 chr3A 95.863 701 26 2 2293 2993 17451638 17450941 0.000000e+00 1131
4 TraesCS3D01G029900 chr3A 88.543 611 58 4 2386 2993 17509396 17508795 0.000000e+00 730
5 TraesCS3D01G029900 chrUn 99.582 1434 6 0 4 1437 43590218 43591651 0.000000e+00 2615
6 TraesCS3D01G029900 chrUn 100.000 718 0 0 2276 2993 314619709 314620426 0.000000e+00 1327
7 TraesCS3D01G029900 chr3B 86.923 2233 239 23 56 2250 26398475 26400692 0.000000e+00 2457
8 TraesCS3D01G029900 chr3B 86.789 2233 242 23 56 2250 26056308 26058525 0.000000e+00 2440
9 TraesCS3D01G029900 chr3B 86.447 2280 229 30 14 2250 15168104 15165862 0.000000e+00 2425
10 TraesCS3D01G029900 chr3B 86.652 2225 250 30 56 2250 25920195 25922402 0.000000e+00 2420
11 TraesCS3D01G029900 chr3B 86.123 2270 261 33 12 2252 15096480 15098724 0.000000e+00 2398
12 TraesCS3D01G029900 chr3B 86.443 2235 247 25 56 2250 26429131 26431349 0.000000e+00 2398
13 TraesCS3D01G029900 chr3B 86.433 2226 253 31 56 2250 26245306 26247513 0.000000e+00 2392
14 TraesCS3D01G029900 chr3B 85.947 2270 266 32 12 2252 15142703 15140458 0.000000e+00 2375
15 TraesCS3D01G029900 chr3B 85.753 730 88 11 138 860 26401540 26402260 0.000000e+00 758
16 TraesCS3D01G029900 chr3B 85.616 730 89 11 138 860 26059373 26060093 0.000000e+00 752
17 TraesCS3D01G029900 chr3B 85.499 731 88 12 138 860 25923249 25923969 0.000000e+00 747
18 TraesCS3D01G029900 chr3B 85.342 730 91 11 138 860 26248442 26249162 0.000000e+00 741
19 TraesCS3D01G029900 chr3B 89.977 429 36 3 504 928 15164606 15164181 5.640000e-152 547
20 TraesCS3D01G029900 chr3B 90.859 361 26 3 504 860 26432588 26432945 7.510000e-131 477
21 TraesCS3D01G029900 chr3B 90.110 364 35 1 141 504 15164997 15164635 3.490000e-129 472
22 TraesCS3D01G029900 chr3B 89.130 368 37 3 138 504 26432194 26432559 3.520000e-124 455


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G029900 chr3D 10803087 10806079 2992 False 5528.0 5528 100.000000 1 2993 1 chr3D.!!$F1 2992
1 TraesCS3D01G029900 chr3D 10818689 10819406 717 False 1327.0 1327 100.000000 2276 2993 1 chr3D.!!$F2 717
2 TraesCS3D01G029900 chr3A 17450941 17453953 3012 True 2403.0 3675 96.054500 4 2993 2 chr3A.!!$R2 2989
3 TraesCS3D01G029900 chr3A 17508795 17509396 601 True 730.0 730 88.543000 2386 2993 1 chr3A.!!$R1 607
4 TraesCS3D01G029900 chrUn 43590218 43591651 1433 False 2615.0 2615 99.582000 4 1437 1 chrUn.!!$F1 1433
5 TraesCS3D01G029900 chrUn 314619709 314620426 717 False 1327.0 1327 100.000000 2276 2993 1 chrUn.!!$F2 717
6 TraesCS3D01G029900 chr3B 15096480 15098724 2244 False 2398.0 2398 86.123000 12 2252 1 chr3B.!!$F1 2240
7 TraesCS3D01G029900 chr3B 15140458 15142703 2245 True 2375.0 2375 85.947000 12 2252 1 chr3B.!!$R1 2240
8 TraesCS3D01G029900 chr3B 26398475 26402260 3785 False 1607.5 2457 86.338000 56 2250 2 chr3B.!!$F5 2194
9 TraesCS3D01G029900 chr3B 26056308 26060093 3785 False 1596.0 2440 86.202500 56 2250 2 chr3B.!!$F3 2194
10 TraesCS3D01G029900 chr3B 25920195 25923969 3774 False 1583.5 2420 86.075500 56 2250 2 chr3B.!!$F2 2194
11 TraesCS3D01G029900 chr3B 26245306 26249162 3856 False 1566.5 2392 85.887500 56 2250 2 chr3B.!!$F4 2194
12 TraesCS3D01G029900 chr3B 15164181 15168104 3923 True 1148.0 2425 88.844667 14 2250 3 chr3B.!!$R2 2236
13 TraesCS3D01G029900 chr3B 26429131 26432945 3814 False 1110.0 2398 88.810667 56 2250 3 chr3B.!!$F6 2194

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
91 92 4.020751 ACTTTAGCTTGCTCTGTGATCTCA 60.021 41.667 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2016 2076 3.099141 CCATCACTTGCCCTGGTAAATT 58.901 45.455 0.0 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 68 8.402798 TCTCTTCATGCACAAAGGTAAATTAA 57.597 30.769 9.39 0.0 0.00 1.40
91 92 4.020751 ACTTTAGCTTGCTCTGTGATCTCA 60.021 41.667 0.00 0.0 0.00 3.27
1437 1497 0.033504 GGTGTGACTGTCACCGTCAT 59.966 55.000 31.58 0.0 46.40 3.06
1876 1936 4.680237 CGCTGGCGAACCTCACCA 62.680 66.667 9.51 0.0 42.83 4.17
2016 2076 3.932710 GAGCAATGTCTGTCGACCAATTA 59.067 43.478 14.12 0.0 39.47 1.40
2044 2105 2.094390 CAGGGCAAGTGATGGATTTGTG 60.094 50.000 0.00 0.0 0.00 3.33
2052 2113 7.189512 GCAAGTGATGGATTTGTGATAACTAC 58.810 38.462 0.00 0.0 0.00 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 68 4.904241 AGATCACAGAGCAAGCTAAAGTT 58.096 39.130 0.00 0.0 0.00 2.66
91 92 8.635765 ACCCATGCGATTTCAGTATTATATTT 57.364 30.769 0.00 0.0 0.00 1.40
1501 1561 3.936203 TCGAAGTGCGGCCTTGGT 61.936 61.111 0.00 0.0 41.33 3.67
2016 2076 3.099141 CCATCACTTGCCCTGGTAAATT 58.901 45.455 0.00 0.0 0.00 1.82
2173 2236 9.764363 AGAATACGCAATTGATCTAATGAACTA 57.236 29.630 10.34 0.0 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.