Multiple sequence alignment - TraesCS3D01G005200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G005200 chr3D 100.000 2608 0 0 1 2608 2046103 2043496 0.000000e+00 4817.0
1 TraesCS3D01G005200 chr3D 98.314 2609 37 3 1 2608 166983439 166986041 0.000000e+00 4567.0
2 TraesCS3D01G005200 chr3D 98.122 2609 45 2 1 2605 360365408 360368016 0.000000e+00 4543.0
3 TraesCS3D01G005200 chr7D 98.351 2608 39 4 1 2608 460098817 460101420 0.000000e+00 4575.0
4 TraesCS3D01G005200 chr7D 98.201 2612 38 3 1 2608 530382800 530380194 0.000000e+00 4554.0
5 TraesCS3D01G005200 chr5D 98.200 2611 41 5 1 2608 532625856 532628463 0.000000e+00 4556.0
6 TraesCS3D01G005200 chr4D 98.089 2617 41 3 1 2608 338461877 338464493 0.000000e+00 4547.0
7 TraesCS3D01G005200 chr1D 97.822 2617 46 4 3 2608 419200471 419203087 0.000000e+00 4506.0
8 TraesCS3D01G005200 chr1D 97.515 2616 52 5 3 2608 486229691 486232303 0.000000e+00 4458.0
9 TraesCS3D01G005200 chr1D 98.000 50 1 0 1 50 303046114 303046065 1.290000e-13 87.9
10 TraesCS3D01G005200 chr6D 97.631 2617 46 5 3 2608 6286937 6284326 0.000000e+00 4475.0
11 TraesCS3D01G005200 chr3A 95.833 72 3 0 1 72 733164828 733164899 1.640000e-22 117.0
12 TraesCS3D01G005200 chr5A 96.923 65 2 0 1 65 647457461 647457525 2.740000e-20 110.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G005200 chr3D 2043496 2046103 2607 True 4817 4817 100.000 1 2608 1 chr3D.!!$R1 2607
1 TraesCS3D01G005200 chr3D 166983439 166986041 2602 False 4567 4567 98.314 1 2608 1 chr3D.!!$F1 2607
2 TraesCS3D01G005200 chr3D 360365408 360368016 2608 False 4543 4543 98.122 1 2605 1 chr3D.!!$F2 2604
3 TraesCS3D01G005200 chr7D 460098817 460101420 2603 False 4575 4575 98.351 1 2608 1 chr7D.!!$F1 2607
4 TraesCS3D01G005200 chr7D 530380194 530382800 2606 True 4554 4554 98.201 1 2608 1 chr7D.!!$R1 2607
5 TraesCS3D01G005200 chr5D 532625856 532628463 2607 False 4556 4556 98.200 1 2608 1 chr5D.!!$F1 2607
6 TraesCS3D01G005200 chr4D 338461877 338464493 2616 False 4547 4547 98.089 1 2608 1 chr4D.!!$F1 2607
7 TraesCS3D01G005200 chr1D 419200471 419203087 2616 False 4506 4506 97.822 3 2608 1 chr1D.!!$F1 2605
8 TraesCS3D01G005200 chr1D 486229691 486232303 2612 False 4458 4458 97.515 3 2608 1 chr1D.!!$F2 2605
9 TraesCS3D01G005200 chr6D 6284326 6286937 2611 True 4475 4475 97.631 3 2608 1 chr6D.!!$R1 2605

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
479 509 2.125713 CCGCGGTCAGTGCACATA 60.126 61.111 19.5 2.9 0.0 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1628 1659 0.904649 AATGTCTCGAGTGGATGGCA 59.095 50.0 13.13 0.0 0.0 4.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
370 400 4.210955 CCAACGAAAATGGGTTGACAATTG 59.789 41.667 3.24 3.24 44.80 2.32
386 416 8.882736 GTTGACAATTGTTTCTGGAAATTCTTT 58.117 29.630 13.36 0.00 32.36 2.52
479 509 2.125713 CCGCGGTCAGTGCACATA 60.126 61.111 19.50 2.90 0.00 2.29
584 615 9.218525 CCTACAATCATGGATATATACCTTCCT 57.781 37.037 0.00 0.00 0.00 3.36
728 759 3.083349 TCCACGGCTCCTCCCATG 61.083 66.667 0.00 0.00 0.00 3.66
1025 1056 0.323302 TCAGAGGCGCATAACAACCA 59.677 50.000 10.83 0.00 0.00 3.67
1116 1147 5.746245 CGCTGAGGTAGATAAGAAACTCAAG 59.254 44.000 0.00 0.00 34.90 3.02
1172 1203 0.034896 GAGCGTGAGGAGTTTTCCCA 59.965 55.000 0.00 0.00 45.24 4.37
1211 1242 5.142962 GCGTCTTGAGATTGAAGAAAAGTG 58.857 41.667 0.00 0.00 31.27 3.16
1290 1321 0.179067 AAACGTTGCAGAAGGACCGA 60.179 50.000 0.00 0.00 0.00 4.69
1473 1504 4.148825 GCGATCTCACGGCCACCT 62.149 66.667 2.24 0.00 0.00 4.00
1628 1659 1.730501 CATCATGAGACGGCACAGTT 58.269 50.000 0.09 0.00 0.00 3.16
2529 2561 6.846350 AGAAAGAACAAGAACAACTTCAGTG 58.154 36.000 0.00 0.00 36.61 3.66
2542 2574 7.011499 ACAACTTCAGTGGTATGGTTACATA 57.989 36.000 0.00 0.00 38.53 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 3.071786 CGCAAGTACGATCTCTGACAT 57.928 47.619 0.00 0.0 34.06 3.06
370 400 8.893219 AATTCCTTCAAAGAATTTCCAGAAAC 57.107 30.769 0.00 0.0 40.23 2.78
568 599 7.504911 GCGGTAGAATAGGAAGGTATATATCCA 59.495 40.741 4.13 0.0 35.62 3.41
584 615 6.097839 GGATAGGGTTGATATGCGGTAGAATA 59.902 42.308 0.00 0.0 0.00 1.75
728 759 2.907910 AATCAGCACTGCAATCGAAC 57.092 45.000 3.30 0.0 0.00 3.95
1025 1056 1.174783 AGACTTGTCGTACTCCGCAT 58.825 50.000 0.00 0.0 36.19 4.73
1172 1203 2.036475 AGACGCATCTTCGCCATCTTAT 59.964 45.455 0.00 0.0 0.00 1.73
1211 1242 0.108756 GTCCTCACAGTCCCGCTTAC 60.109 60.000 0.00 0.0 0.00 2.34
1290 1321 7.549488 GTCTGTATAATACTGTCCACAAGCTTT 59.451 37.037 0.00 0.0 0.00 3.51
1391 1422 3.806949 TGGCCTTATAATCCATGTCCC 57.193 47.619 3.32 0.0 0.00 4.46
1556 1587 5.050159 GGTTGCCACAAATTGAAGATGTTTC 60.050 40.000 0.00 0.0 0.00 2.78
1628 1659 0.904649 AATGTCTCGAGTGGATGGCA 59.095 50.000 13.13 0.0 0.00 4.92
2542 2574 9.905171 GCTTCAATCTTTTTCTCTTTAACATCT 57.095 29.630 0.00 0.0 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.