Multiple sequence alignment - TraesCS3B01G612900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G612900 chr3B 100.000 2855 0 0 1 2855 830609856 830612710 0.000000e+00 5273
1 TraesCS3B01G612900 chr3B 98.914 2855 20 2 1 2855 830319841 830322684 0.000000e+00 5090
2 TraesCS3B01G612900 chr3B 93.541 1858 54 21 848 2661 829935228 829937063 0.000000e+00 2706
3 TraesCS3B01G612900 chr3B 91.537 1926 72 32 987 2855 829986375 829988266 0.000000e+00 2569
4 TraesCS3B01G612900 chr3B 91.291 1929 75 33 987 2855 830486769 830488664 0.000000e+00 2545
5 TraesCS3B01G612900 chr3B 91.239 1929 75 33 987 2855 830150756 830152650 0.000000e+00 2540
6 TraesCS3B01G612900 chr3B 91.230 1927 77 31 987 2855 830407667 830409559 0.000000e+00 2538
7 TraesCS3B01G612900 chr3B 91.173 1926 78 33 987 2855 830426264 830428154 0.000000e+00 2531
8 TraesCS3B01G612900 chr3B 91.079 1928 79 33 987 2855 830213110 830215003 0.000000e+00 2521
9 TraesCS3B01G612900 chr3B 90.700 1914 97 35 987 2855 830112164 830114041 0.000000e+00 2473
10 TraesCS3B01G612900 chr3B 94.312 1600 32 15 1300 2855 830056144 830057728 0.000000e+00 2396
11 TraesCS3B01G612900 chr3B 90.479 1481 73 24 1433 2855 829743279 829744749 0.000000e+00 1892
12 TraesCS3B01G612900 chr3B 93.211 1252 37 10 1209 2421 830249878 830251120 0.000000e+00 1797
13 TraesCS3B01G612900 chr3B 92.971 1252 38 10 1209 2421 827515928 827514688 0.000000e+00 1779
14 TraesCS3B01G612900 chr3B 92.013 1252 36 10 1209 2421 830524074 830525300 0.000000e+00 1700
15 TraesCS3B01G612900 chr3B 94.892 509 23 2 339 847 830055195 830055700 0.000000e+00 793
16 TraesCS3B01G612900 chr3B 94.499 509 25 2 339 847 829934693 829935198 0.000000e+00 782
17 TraesCS3B01G612900 chr3B 95.019 261 13 0 45 305 416309005 416308745 7.360000e-111 411
18 TraesCS3B01G612900 chr3B 100.000 149 0 0 2707 2855 829937623 829937771 2.800000e-70 276
19 TraesCS3B01G612900 chrUn 94.103 2052 55 21 848 2855 184582445 184584474 0.000000e+00 3059
20 TraesCS3B01G612900 chrUn 88.393 1456 47 39 848 2260 366087989 366086613 0.000000e+00 1640
21 TraesCS3B01G612900 chrUn 92.301 1156 40 14 987 2126 347738062 347739184 0.000000e+00 1596
22 TraesCS3B01G612900 chrUn 94.614 984 36 8 987 1957 348009479 348010458 0.000000e+00 1507
23 TraesCS3B01G612900 chrUn 91.561 865 26 9 1586 2411 463261522 463262378 0.000000e+00 1149
24 TraesCS3B01G612900 chrUn 94.499 509 25 2 339 847 184581910 184582415 0.000000e+00 782
25 TraesCS3B01G612900 chrUn 84.694 490 60 7 306 786 33577685 33578168 2.570000e-130 475
26 TraesCS3B01G612900 chrUn 84.694 490 60 7 306 786 33763411 33762928 2.570000e-130 475
27 TraesCS3B01G612900 chrUn 84.553 492 58 10 306 786 33884962 33884478 3.330000e-129 472
28 TraesCS3B01G612900 chrUn 90.000 260 11 6 2609 2855 202222060 202222317 3.550000e-84 322
29 TraesCS3B01G612900 chrUn 90.000 260 11 6 2609 2855 232413511 232413254 3.550000e-84 322
30 TraesCS3B01G612900 chrUn 89.615 260 12 6 2609 2855 344797497 344797240 1.650000e-82 316
31 TraesCS3B01G612900 chrUn 90.870 230 14 3 618 847 43054736 43054958 4.620000e-78 302
32 TraesCS3B01G612900 chrUn 89.300 243 11 6 2626 2855 348010458 348010698 1.000000e-74 291
33 TraesCS3B01G612900 chrUn 94.340 106 6 0 742 847 366088124 366088019 2.280000e-36 163
34 TraesCS3B01G612900 chrUn 94.340 106 6 0 742 847 381855063 381854958 2.280000e-36 163
35 TraesCS3B01G612900 chrUn 94.340 106 6 0 742 847 382035423 382035318 2.280000e-36 163
36 TraesCS3B01G612900 chr3D 88.494 1434 74 25 1228 2597 612004516 612005922 0.000000e+00 1650
37 TraesCS3B01G612900 chr3D 83.234 1503 137 49 604 2039 611020345 611018891 0.000000e+00 1273
38 TraesCS3B01G612900 chr3D 90.682 440 33 8 304 739 612004015 612004450 1.910000e-161 579
39 TraesCS3B01G612900 chr3D 90.071 282 14 6 2586 2855 612012733 612013012 1.260000e-93 353
40 TraesCS3B01G612900 chr7B 98.361 244 4 0 45 288 59877079 59877322 2.030000e-116 429
41 TraesCS3B01G612900 chr7B 97.590 249 6 0 45 293 725423685 725423933 7.310000e-116 427
42 TraesCS3B01G612900 chr2B 98.361 244 4 0 45 288 517503705 517503462 2.030000e-116 429
43 TraesCS3B01G612900 chr2B 97.581 248 6 0 41 288 298132485 298132238 2.630000e-115 425
44 TraesCS3B01G612900 chr2A 97.600 250 6 0 41 290 660270404 660270155 2.030000e-116 429
45 TraesCS3B01G612900 chr4B 97.581 248 6 0 41 288 109844510 109844263 2.630000e-115 425
46 TraesCS3B01G612900 chr4B 97.951 244 5 0 45 288 228594551 228594308 9.460000e-115 424


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G612900 chr3B 830609856 830612710 2854 False 5273.000000 5273 100.000000 1 2855 1 chr3B.!!$F12 2854
1 TraesCS3B01G612900 chr3B 830319841 830322684 2843 False 5090.000000 5090 98.914000 1 2855 1 chr3B.!!$F7 2854
2 TraesCS3B01G612900 chr3B 829986375 829988266 1891 False 2569.000000 2569 91.537000 987 2855 1 chr3B.!!$F2 1868
3 TraesCS3B01G612900 chr3B 830486769 830488664 1895 False 2545.000000 2545 91.291000 987 2855 1 chr3B.!!$F10 1868
4 TraesCS3B01G612900 chr3B 830150756 830152650 1894 False 2540.000000 2540 91.239000 987 2855 1 chr3B.!!$F4 1868
5 TraesCS3B01G612900 chr3B 830407667 830409559 1892 False 2538.000000 2538 91.230000 987 2855 1 chr3B.!!$F8 1868
6 TraesCS3B01G612900 chr3B 830426264 830428154 1890 False 2531.000000 2531 91.173000 987 2855 1 chr3B.!!$F9 1868
7 TraesCS3B01G612900 chr3B 830213110 830215003 1893 False 2521.000000 2521 91.079000 987 2855 1 chr3B.!!$F5 1868
8 TraesCS3B01G612900 chr3B 830112164 830114041 1877 False 2473.000000 2473 90.700000 987 2855 1 chr3B.!!$F3 1868
9 TraesCS3B01G612900 chr3B 829743279 829744749 1470 False 1892.000000 1892 90.479000 1433 2855 1 chr3B.!!$F1 1422
10 TraesCS3B01G612900 chr3B 830249878 830251120 1242 False 1797.000000 1797 93.211000 1209 2421 1 chr3B.!!$F6 1212
11 TraesCS3B01G612900 chr3B 827514688 827515928 1240 True 1779.000000 1779 92.971000 1209 2421 1 chr3B.!!$R2 1212
12 TraesCS3B01G612900 chr3B 830524074 830525300 1226 False 1700.000000 1700 92.013000 1209 2421 1 chr3B.!!$F11 1212
13 TraesCS3B01G612900 chr3B 830055195 830057728 2533 False 1594.500000 2396 94.602000 339 2855 2 chr3B.!!$F14 2516
14 TraesCS3B01G612900 chr3B 829934693 829937771 3078 False 1254.666667 2706 96.013333 339 2855 3 chr3B.!!$F13 2516
15 TraesCS3B01G612900 chrUn 184581910 184584474 2564 False 1920.500000 3059 94.301000 339 2855 2 chrUn.!!$F6 2516
16 TraesCS3B01G612900 chrUn 347738062 347739184 1122 False 1596.000000 1596 92.301000 987 2126 1 chrUn.!!$F4 1139
17 TraesCS3B01G612900 chrUn 463261522 463262378 856 False 1149.000000 1149 91.561000 1586 2411 1 chrUn.!!$F5 825
18 TraesCS3B01G612900 chrUn 366086613 366088124 1511 True 901.500000 1640 91.366500 742 2260 2 chrUn.!!$R7 1518
19 TraesCS3B01G612900 chrUn 348009479 348010698 1219 False 899.000000 1507 91.957000 987 2855 2 chrUn.!!$F7 1868
20 TraesCS3B01G612900 chr3D 611018891 611020345 1454 True 1273.000000 1273 83.234000 604 2039 1 chr3D.!!$R1 1435
21 TraesCS3B01G612900 chr3D 612004015 612005922 1907 False 1114.500000 1650 89.588000 304 2597 2 chr3D.!!$F2 2293

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
778 798 3.247006 TGAGGTGCGAAGGAATAGTTC 57.753 47.619 0.0 0.0 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2505 2726 2.230025 CACATGTCCCATGCGGTTTTTA 59.77 45.455 0.0 0.0 0.0 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
778 798 3.247006 TGAGGTGCGAAGGAATAGTTC 57.753 47.619 0.00 0.00 0.00 3.01
812 832 5.585390 CGGTGTACGTAGTTATCCTTTGAT 58.415 41.667 0.00 0.00 37.78 2.57
859 908 4.147653 CAGCGCATACCTTAATGTACGTAC 59.852 45.833 18.90 18.90 0.00 3.67
865 914 3.444029 ACCTTAATGTACGTACCCCAGT 58.556 45.455 22.43 9.79 0.00 4.00
1575 1695 1.395045 TTCTCCTCGAGGCGATGCAT 61.395 55.000 27.39 0.00 34.61 3.96
2162 2356 1.535462 GTCAATCTTTGGTGTGGACGG 59.465 52.381 0.00 0.00 0.00 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
760 780 2.693267 GGAACTATTCCTTCGCACCT 57.307 50.000 0.10 0.00 46.57 4.00
812 832 5.416083 AGCTGTATACATTAAACTCACGCA 58.584 37.500 5.91 0.00 0.00 5.24
859 908 1.064389 GGAATCCCTTCTTCACTGGGG 60.064 57.143 0.00 0.00 41.22 4.96
865 914 2.111384 CGGAGAGGAATCCCTTCTTCA 58.889 52.381 0.00 0.00 44.53 3.02
1575 1695 4.429522 ATGCGGCTCATGTGGGCA 62.430 61.111 7.24 9.77 38.09 5.36
2505 2726 2.230025 CACATGTCCCATGCGGTTTTTA 59.770 45.455 0.00 0.00 0.00 1.52
2574 2802 5.534278 TCATGTTGCATGTTGGTCTCTTTTA 59.466 36.000 8.68 0.00 0.00 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.