Multiple sequence alignment - TraesCS3B01G612700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G612700 chr3B 100.000 2585 0 0 1 2585 830111178 830113762 0 4774
1 TraesCS3B01G612700 chr3B 98.158 2606 20 6 1 2585 829985389 829987987 0 4521
2 TraesCS3B01G612700 chr3B 97.852 2607 33 6 1 2585 830149766 830152371 0 4482
3 TraesCS3B01G612700 chr3B 97.775 2607 34 8 1 2585 830406676 830409280 0 4471
4 TraesCS3B01G612700 chr3B 97.699 2607 34 9 1 2585 830425273 830427875 0 4458
5 TraesCS3B01G612700 chr3B 97.622 2607 37 6 1 2585 830485782 830488385 0 4447
6 TraesCS3B01G612700 chr3B 97.545 2607 36 8 1 2585 830212124 830214724 0 4434
7 TraesCS3B01G612700 chr3B 97.276 2606 37 7 1 2585 830178237 830180829 0 4388
8 TraesCS3B01G612700 chr3B 97.122 2606 40 7 1 2585 830451889 830454480 0 4364
9 TraesCS3B01G612700 chr3B 93.467 1194 35 11 1433 2585 829743279 829744470 0 1733
10 TraesCS3B01G612700 chr3B 93.657 536 11 4 2044 2562 829815868 829816397 0 780
11 TraesCS3B01G612700 chrUn 98.438 2113 29 2 1 2109 347737072 347739184 0 3716


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G612700 chr3B 830111178 830113762 2584 False 4774 4774 100.000 1 2585 1 chr3B.!!$F4 2584
1 TraesCS3B01G612700 chr3B 829985389 829987987 2598 False 4521 4521 98.158 1 2585 1 chr3B.!!$F3 2584
2 TraesCS3B01G612700 chr3B 830149766 830152371 2605 False 4482 4482 97.852 1 2585 1 chr3B.!!$F5 2584
3 TraesCS3B01G612700 chr3B 830406676 830409280 2604 False 4471 4471 97.775 1 2585 1 chr3B.!!$F8 2584
4 TraesCS3B01G612700 chr3B 830425273 830427875 2602 False 4458 4458 97.699 1 2585 1 chr3B.!!$F9 2584
5 TraesCS3B01G612700 chr3B 830485782 830488385 2603 False 4447 4447 97.622 1 2585 1 chr3B.!!$F11 2584
6 TraesCS3B01G612700 chr3B 830212124 830214724 2600 False 4434 4434 97.545 1 2585 1 chr3B.!!$F7 2584
7 TraesCS3B01G612700 chr3B 830178237 830180829 2592 False 4388 4388 97.276 1 2585 1 chr3B.!!$F6 2584
8 TraesCS3B01G612700 chr3B 830451889 830454480 2591 False 4364 4364 97.122 1 2585 1 chr3B.!!$F10 2584
9 TraesCS3B01G612700 chr3B 829743279 829744470 1191 False 1733 1733 93.467 1433 2585 1 chr3B.!!$F1 1152
10 TraesCS3B01G612700 chr3B 829815868 829816397 529 False 780 780 93.657 2044 2562 1 chr3B.!!$F2 518
11 TraesCS3B01G612700 chrUn 347737072 347739184 2112 False 3716 3716 98.438 1 2109 1 chrUn.!!$F1 2108

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
64 69 0.187361 CCCCTCCCCTCAAAACAACA 59.813 55.0 0.0 0.0 0.0 3.33 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1710 1725 1.381327 CCTCGAACCCCTGCTCCTA 60.381 63.158 0.0 0.0 0.0 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 68 0.481128 TCCCCTCCCCTCAAAACAAC 59.519 55.000 0.00 0.00 0.00 3.32
64 69 0.187361 CCCCTCCCCTCAAAACAACA 59.813 55.000 0.00 0.00 0.00 3.33
65 70 1.412361 CCCCTCCCCTCAAAACAACAA 60.412 52.381 0.00 0.00 0.00 2.83
66 71 2.393646 CCCTCCCCTCAAAACAACAAA 58.606 47.619 0.00 0.00 0.00 2.83
100 105 4.025979 GGCTCGTACGTCCAATTGATTAAG 60.026 45.833 16.05 1.23 0.00 1.85
623 633 4.693566 TCTTACGGTTGATTTGGTCATCAC 59.306 41.667 0.00 0.00 36.54 3.06
705 715 8.030913 AGTATTAGGTGACTTGGGTTATAAGG 57.969 38.462 0.00 0.00 43.67 2.69
1129 1139 0.962356 CTTCAGCAAGGCCACGGATT 60.962 55.000 5.01 0.00 0.00 3.01
1537 1549 1.416813 GCAGATGAAGGACGCGTCTG 61.417 60.000 35.50 24.94 46.91 3.51
1569 1581 2.992114 AGGTTCTGCTCGAGGCGT 60.992 61.111 15.58 0.00 45.43 5.68
1938 1954 1.651240 GCTTGATGTGATGCTGCCGT 61.651 55.000 0.00 0.00 0.00 5.68
2209 2249 8.833231 TTTCGTCAATATTTTTATTTGGCCAA 57.167 26.923 16.05 16.05 0.00 4.52
2367 2424 9.507329 ACTCACATAATCTACAATTTTGACACT 57.493 29.630 0.00 0.00 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 105 3.900941 AGATGGTGCGTCAAACATTTTC 58.099 40.909 0.00 0.0 0.0 2.29
109 115 3.305267 CCAAATTTTGAGATGGTGCGTCA 60.305 43.478 10.72 0.0 0.0 4.35
623 633 5.180271 TGGGCAAGTAAAGTAAATACGAGG 58.820 41.667 0.00 0.0 0.0 4.63
705 715 1.335810 GGTTTGGTTCGGTTCTGTTCC 59.664 52.381 0.00 0.0 0.0 3.62
1569 1581 3.364441 GCTCATGTGGGCGTGCAA 61.364 61.111 0.00 0.0 0.0 4.08
1710 1725 1.381327 CCTCGAACCCCTGCTCCTA 60.381 63.158 0.00 0.0 0.0 2.94
1938 1954 2.741092 GGCAGTGAACTCCGGACA 59.259 61.111 0.00 0.0 0.0 4.02
2367 2424 9.474920 CTCAGCCATTAAAAATTCTGTTAAACA 57.525 29.630 0.00 0.0 0.0 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.