Multiple sequence alignment - TraesCS3B01G612600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G612600 chr3B 100.000 3262 0 0 1 3262 830054777 830058038 0.000000e+00 6024.0
1 TraesCS3B01G612600 chr3B 95.079 1910 35 14 1368 3262 830321129 830322994 0.000000e+00 2952.0
2 TraesCS3B01G612600 chr3B 95.079 1910 35 15 1368 3262 830611155 830613020 0.000000e+00 2952.0
3 TraesCS3B01G612600 chr3B 92.698 1931 79 19 1368 3262 830151069 830152973 0.000000e+00 2728.0
4 TraesCS3B01G612600 chr3B 92.650 1932 82 22 1365 3262 829986685 829988590 0.000000e+00 2726.0
5 TraesCS3B01G612600 chr3B 91.889 1948 83 23 1365 3262 830487079 830489001 0.000000e+00 2652.0
6 TraesCS3B01G612600 chr3B 99.134 1386 10 1 1 1384 829934273 829935658 0.000000e+00 2492.0
7 TraesCS3B01G612600 chr3B 98.850 1391 13 3 1368 2758 829935676 829937063 0.000000e+00 2477.0
8 TraesCS3B01G612600 chr3B 91.620 1802 81 23 1502 3262 829743279 829745051 0.000000e+00 2427.0
9 TraesCS3B01G612600 chr3B 96.367 1156 27 4 1372 2518 830249971 830251120 0.000000e+00 1888.0
10 TraesCS3B01G612600 chr3B 95.761 1156 31 5 1372 2518 827515834 827514688 0.000000e+00 1847.0
11 TraesCS3B01G612600 chr3B 94.896 1156 27 5 1372 2518 830524168 830525300 0.000000e+00 1779.0
12 TraesCS3B01G612600 chr3B 93.266 698 22 9 697 1389 829741983 829742660 0.000000e+00 1005.0
13 TraesCS3B01G612600 chr3B 99.346 459 3 0 2804 3262 829937623 829938081 0.000000e+00 832.0
14 TraesCS3B01G612600 chr3B 95.678 509 19 2 419 924 830320179 830320687 0.000000e+00 815.0
15 TraesCS3B01G612600 chr3B 94.892 509 23 2 419 924 830610194 830610702 0.000000e+00 793.0
16 TraesCS3B01G612600 chr3B 93.409 531 18 6 858 1385 829817149 829817665 0.000000e+00 771.0
17 TraesCS3B01G612600 chr3B 89.286 616 29 12 697 1311 829878408 829878987 0.000000e+00 737.0
18 TraesCS3B01G612600 chr3B 88.853 619 33 11 697 1315 830244547 830245129 0.000000e+00 728.0
19 TraesCS3B01G612600 chr3B 88.871 620 32 16 697 1315 830518743 830519326 0.000000e+00 728.0
20 TraesCS3B01G612600 chr3B 89.537 583 33 10 2706 3262 829818708 829819288 0.000000e+00 713.0
21 TraesCS3B01G612600 chr3B 94.737 437 17 5 954 1385 830610703 830611138 0.000000e+00 675.0
22 TraesCS3B01G612600 chr3B 95.059 425 15 5 966 1385 830320689 830321112 0.000000e+00 664.0
23 TraesCS3B01G612600 chr3B 99.652 287 1 0 2976 3262 830065616 830065902 2.880000e-145 525.0
24 TraesCS3B01G612600 chr3B 96.774 310 10 0 1080 1389 830112155 830112464 4.820000e-143 518.0
25 TraesCS3B01G612600 chr3B 96.774 310 10 0 1080 1389 830213101 830213410 4.820000e-143 518.0
26 TraesCS3B01G612600 chr3B 83.537 328 45 8 105 428 497707057 497706735 6.840000e-77 298.0
27 TraesCS3B01G612600 chr3B 88.732 71 5 3 1 70 830314270 830314338 2.090000e-12 84.2
28 TraesCS3B01G612600 chr3B 88.732 71 5 3 1 70 830604473 830604541 2.090000e-12 84.2
29 TraesCS3B01G612600 chrUn 98.945 1895 17 3 1368 3262 184582893 184584784 0.000000e+00 3386.0
30 TraesCS3B01G612600 chrUn 99.206 1385 10 1 1 1384 184581491 184582875 0.000000e+00 2495.0
31 TraesCS3B01G612600 chrUn 96.387 858 22 3 1661 2509 463261522 463262379 0.000000e+00 1404.0
32 TraesCS3B01G612600 chrUn 93.772 835 26 6 1368 2201 347738375 347739184 0.000000e+00 1230.0
33 TraesCS3B01G612600 chrUn 93.220 531 19 6 858 1385 184613630 184614146 0.000000e+00 765.0
34 TraesCS3B01G612600 chrUn 89.286 616 29 12 697 1311 43054736 43055315 0.000000e+00 737.0
35 TraesCS3B01G612600 chrUn 89.555 584 32 10 2706 3262 202222060 202222641 0.000000e+00 713.0
36 TraesCS3B01G612600 chrUn 89.555 584 32 10 2706 3262 232413511 232412930 0.000000e+00 713.0
37 TraesCS3B01G612600 chrUn 89.212 584 34 10 2706 3262 184615192 184615773 0.000000e+00 702.0
38 TraesCS3B01G612600 chrUn 89.212 584 34 10 2706 3262 461130944 461130363 0.000000e+00 702.0
39 TraesCS3B01G612600 chrUn 89.399 566 31 10 2706 3244 344797497 344796934 0.000000e+00 686.0
40 TraesCS3B01G612600 chrUn 93.067 375 9 6 858 1229 202220539 202220899 1.720000e-147 532.0
41 TraesCS3B01G612600 chrUn 93.067 375 9 6 858 1229 204469086 204469446 1.720000e-147 532.0
42 TraesCS3B01G612600 chrUn 85.011 447 50 10 428 863 33577728 33578168 3.860000e-119 438.0
43 TraesCS3B01G612600 chrUn 85.011 447 50 9 428 863 33763368 33762928 3.860000e-119 438.0
44 TraesCS3B01G612600 chrUn 84.821 448 50 9 428 863 33884919 33884478 5.000000e-118 435.0
45 TraesCS3B01G612600 chrUn 90.184 326 28 3 104 428 337677962 337678284 3.890000e-114 422.0
46 TraesCS3B01G612600 chrUn 89.877 326 29 3 104 428 384396269 384396591 1.810000e-112 416.0
47 TraesCS3B01G612600 chrUn 88.966 290 27 4 139 428 96160757 96161041 1.440000e-93 353.0
48 TraesCS3B01G612600 chr3D 90.248 605 32 10 2683 3262 612012733 612013335 0.000000e+00 765.0
49 TraesCS3B01G612600 chr3D 90.571 403 30 8 422 819 612004053 612004452 8.020000e-146 527.0
50 TraesCS3B01G612600 chr3D 94.545 110 5 1 1 110 612003954 612004062 5.600000e-38 169.0
51 TraesCS3B01G612600 chr6D 90.184 326 28 3 104 428 467145647 467145969 3.890000e-114 422.0
52 TraesCS3B01G612600 chr1D 85.127 316 40 6 115 428 263566967 263566657 1.890000e-82 316.0
53 TraesCS3B01G612600 chr3A 82.875 327 49 6 105 428 505218664 505218342 1.480000e-73 287.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G612600 chr3B 830054777 830058038 3261 False 6024.000000 6024 100.000000 1 3262 1 chr3B.!!$F3 3261
1 TraesCS3B01G612600 chr3B 830151069 830152973 1904 False 2728.000000 2728 92.698000 1368 3262 1 chr3B.!!$F6 1894
2 TraesCS3B01G612600 chr3B 829986685 829988590 1905 False 2726.000000 2726 92.650000 1365 3262 1 chr3B.!!$F2 1897
3 TraesCS3B01G612600 chr3B 830487079 830489001 1922 False 2652.000000 2652 91.889000 1365 3262 1 chr3B.!!$F11 1897
4 TraesCS3B01G612600 chr3B 829934273 829938081 3808 False 1933.666667 2492 99.110000 1 3262 3 chr3B.!!$F17 3261
5 TraesCS3B01G612600 chr3B 830249971 830251120 1149 False 1888.000000 1888 96.367000 1372 2518 1 chr3B.!!$F9 1146
6 TraesCS3B01G612600 chr3B 827514688 827515834 1146 True 1847.000000 1847 95.761000 1372 2518 1 chr3B.!!$R2 1146
7 TraesCS3B01G612600 chr3B 830524168 830525300 1132 False 1779.000000 1779 94.896000 1372 2518 1 chr3B.!!$F13 1146
8 TraesCS3B01G612600 chr3B 829741983 829745051 3068 False 1716.000000 2427 92.443000 697 3262 2 chr3B.!!$F15 2565
9 TraesCS3B01G612600 chr3B 830320179 830322994 2815 False 1477.000000 2952 95.272000 419 3262 3 chr3B.!!$F18 2843
10 TraesCS3B01G612600 chr3B 830610194 830613020 2826 False 1473.333333 2952 94.902667 419 3262 3 chr3B.!!$F19 2843
11 TraesCS3B01G612600 chr3B 829817149 829819288 2139 False 742.000000 771 91.473000 858 3262 2 chr3B.!!$F16 2404
12 TraesCS3B01G612600 chr3B 829878408 829878987 579 False 737.000000 737 89.286000 697 1311 1 chr3B.!!$F1 614
13 TraesCS3B01G612600 chr3B 830244547 830245129 582 False 728.000000 728 88.853000 697 1315 1 chr3B.!!$F8 618
14 TraesCS3B01G612600 chr3B 830518743 830519326 583 False 728.000000 728 88.871000 697 1315 1 chr3B.!!$F12 618
15 TraesCS3B01G612600 chrUn 184581491 184584784 3293 False 2940.500000 3386 99.075500 1 3262 2 chrUn.!!$F9 3261
16 TraesCS3B01G612600 chrUn 463261522 463262379 857 False 1404.000000 1404 96.387000 1661 2509 1 chrUn.!!$F8 848
17 TraesCS3B01G612600 chrUn 347738375 347739184 809 False 1230.000000 1230 93.772000 1368 2201 1 chrUn.!!$F6 833
18 TraesCS3B01G612600 chrUn 43054736 43055315 579 False 737.000000 737 89.286000 697 1311 1 chrUn.!!$F2 614
19 TraesCS3B01G612600 chrUn 184613630 184615773 2143 False 733.500000 765 91.216000 858 3262 2 chrUn.!!$F10 2404
20 TraesCS3B01G612600 chrUn 232412930 232413511 581 True 713.000000 713 89.555000 2706 3262 1 chrUn.!!$R3 556
21 TraesCS3B01G612600 chrUn 461130363 461130944 581 True 702.000000 702 89.212000 2706 3262 1 chrUn.!!$R5 556
22 TraesCS3B01G612600 chrUn 344796934 344797497 563 True 686.000000 686 89.399000 2706 3244 1 chrUn.!!$R4 538
23 TraesCS3B01G612600 chrUn 202220539 202222641 2102 False 622.500000 713 91.311000 858 3262 2 chrUn.!!$F11 2404
24 TraesCS3B01G612600 chr3D 612012733 612013335 602 False 765.000000 765 90.248000 2683 3262 1 chr3D.!!$F1 579

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
468 471 0.104120 CATGAGATTGTACCGCCCGA 59.896 55.000 0.00 0.00 0.0 5.14 F
1487 1551 2.034066 CACGGACAAGGCCATGGT 59.966 61.111 14.67 2.98 0.0 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1546 2083 0.031111 TCCTCGTCTCCCATTCCCAT 60.031 55.000 0.0 0.0 0.0 4.00 R
2359 2969 1.409064 GTATCCAGCACAGATCGACCA 59.591 52.381 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
468 471 0.104120 CATGAGATTGTACCGCCCGA 59.896 55.000 0.00 0.00 0.00 5.14
1106 1137 2.393768 CGAGCAAGCGAGCAATGGT 61.394 57.895 6.21 5.52 36.85 3.55
1487 1551 2.034066 CACGGACAAGGCCATGGT 59.966 61.111 14.67 2.98 0.00 3.55
2179 2778 9.202273 CATATGCATCTTCTACTTAAGTCTTCC 57.798 37.037 12.39 0.00 0.00 3.46
2359 2969 7.509141 TGCACCGATATGAATGAAATACAAT 57.491 32.000 0.00 0.00 0.00 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
324 327 4.976116 GGTGCTTAGTTTGTTGTTGCTAAG 59.024 41.667 0.00 0.0 41.74 2.18
413 416 1.561542 ACCCTCAGGCTACTTCCAATG 59.438 52.381 0.00 0.0 36.11 2.82
468 471 7.448469 GCCTTCAAAATATCATACCTACACCAT 59.552 37.037 0.00 0.0 0.00 3.55
1546 2083 0.031111 TCCTCGTCTCCCATTCCCAT 60.031 55.000 0.00 0.0 0.00 4.00
1547 2084 0.976073 GTCCTCGTCTCCCATTCCCA 60.976 60.000 0.00 0.0 0.00 4.37
1548 2085 0.976073 TGTCCTCGTCTCCCATTCCC 60.976 60.000 0.00 0.0 0.00 3.97
1549 2086 1.123928 ATGTCCTCGTCTCCCATTCC 58.876 55.000 0.00 0.0 0.00 3.01
1550 2087 1.202580 CCATGTCCTCGTCTCCCATTC 60.203 57.143 0.00 0.0 0.00 2.67
1551 2088 0.833287 CCATGTCCTCGTCTCCCATT 59.167 55.000 0.00 0.0 0.00 3.16
2329 2939 7.509141 TTTCATTCATATCGGTGCAATACAT 57.491 32.000 0.00 0.0 0.00 2.29
2359 2969 1.409064 GTATCCAGCACAGATCGACCA 59.591 52.381 0.00 0.0 0.00 4.02
2675 3292 3.144657 TCATGTTGCATGTTGGTCTCT 57.855 42.857 8.68 0.0 0.00 3.10
2989 4124 7.303182 TCAGTCTATCTTTTCTTGAAGACCA 57.697 36.000 0.00 0.0 38.39 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.