Multiple sequence alignment - TraesCS3B01G612400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G612400 chr3B 100.000 3456 0 0 1 3456 829816279 829819734 0.000000e+00 6383.0
1 TraesCS3B01G612400 chr3B 93.093 1607 60 14 871 2433 829935132 829936731 0.000000e+00 2305.0
2 TraesCS3B01G612400 chr3B 90.355 1607 52 31 871 2433 830610636 830612183 0.000000e+00 2013.0
3 TraesCS3B01G612400 chr3B 99.126 1030 6 2 2430 3456 830454502 830455531 0.000000e+00 1849.0
4 TraesCS3B01G612400 chr3B 98.637 1027 14 0 2430 3456 830180851 830181877 0.000000e+00 1820.0
5 TraesCS3B01G612400 chr3B 92.237 438 19 1 122 559 829804516 829804938 1.060000e-169 606.0
6 TraesCS3B01G612400 chr3B 92.237 438 19 1 122 559 829808283 829808705 1.060000e-169 606.0
7 TraesCS3B01G612400 chr3B 93.993 283 11 3 122 404 830150309 830150585 1.150000e-114 424.0
8 TraesCS3B01G612400 chr3B 100.000 119 0 0 1 119 829987846 829987964 1.610000e-53 220.0
9 TraesCS3B01G612400 chr3B 100.000 119 0 0 1 119 830113621 830113739 1.610000e-53 220.0
10 TraesCS3B01G612400 chr3B 100.000 119 0 0 1 119 830427735 830427853 1.610000e-53 220.0
11 TraesCS3B01G612400 chr3B 99.160 119 1 0 1 119 830152231 830152349 7.510000e-52 215.0
12 TraesCS3B01G612400 chr3B 99.160 119 1 0 1 119 830180688 830180806 7.510000e-52 215.0
13 TraesCS3B01G612400 chrUn 99.653 3460 8 2 1 3456 184612760 184616219 0.000000e+00 6320.0
14 TraesCS3B01G612400 chrUn 99.041 2190 17 2 1268 3456 202220901 202223087 0.000000e+00 3925.0
15 TraesCS3B01G612400 chrUn 98.995 2190 18 2 1268 3456 232414670 232412484 0.000000e+00 3919.0
16 TraesCS3B01G612400 chrUn 99.191 1730 11 2 1268 2994 344798661 344796932 0.000000e+00 3114.0
17 TraesCS3B01G612400 chrUn 98.516 1752 23 1 1312 3060 374649073 374647322 0.000000e+00 3088.0
18 TraesCS3B01G612400 chrUn 99.050 1474 10 2 1340 2812 396855833 396854363 0.000000e+00 2641.0
19 TraesCS3B01G612400 chrUn 99.552 1338 3 1 1340 2674 410134784 410133447 0.000000e+00 2435.0
20 TraesCS3B01G612400 chrUn 93.155 1607 59 14 871 2433 184582349 184583948 0.000000e+00 2311.0
21 TraesCS3B01G612400 chrUn 94.184 1513 30 10 871 2365 366088085 366086613 0.000000e+00 2254.0
22 TraesCS3B01G612400 chrUn 98.641 1251 17 0 1810 3060 420125290 420126540 0.000000e+00 2217.0
23 TraesCS3B01G612400 chrUn 98.214 1232 6 2 1 1231 204468230 204469446 0.000000e+00 2139.0
24 TraesCS3B01G612400 chrUn 98.058 1236 7 2 1 1234 232415889 232414669 0.000000e+00 2134.0
25 TraesCS3B01G612400 chrUn 99.390 1147 7 0 2310 3456 354628274 354627128 0.000000e+00 2080.0
26 TraesCS3B01G612400 chrUn 99.660 589 2 0 643 1231 202220311 202220899 0.000000e+00 1077.0
27 TraesCS3B01G612400 chrUn 99.493 592 3 0 643 1234 344799251 344798660 0.000000e+00 1077.0
28 TraesCS3B01G612400 chrUn 99.481 578 3 0 2879 3456 392331149 392331726 0.000000e+00 1051.0
29 TraesCS3B01G612400 chrUn 99.481 578 3 0 2879 3456 394685245 394685822 0.000000e+00 1051.0
30 TraesCS3B01G612400 chrUn 100.000 512 0 0 1 512 298233979 298233468 0.000000e+00 946.0
31 TraesCS3B01G612400 chrUn 93.993 283 11 3 122 404 298700837 298700561 1.150000e-114 424.0
32 TraesCS3B01G612400 chrUn 93.993 283 11 3 122 404 347737615 347737891 1.150000e-114 424.0
33 TraesCS3B01G612400 chrUn 93.993 283 11 3 122 404 355565457 355565181 1.150000e-114 424.0
34 TraesCS3B01G612400 chrUn 93.993 283 11 3 122 404 431217339 431217615 1.150000e-114 424.0
35 TraesCS3B01G612400 chrUn 89.175 194 4 4 871 1049 381855024 381854833 3.470000e-55 226.0
36 TraesCS3B01G612400 chrUn 87.838 148 2 3 871 1003 347737910 347738056 3.570000e-35 159.0
37 TraesCS3B01G612400 chrUn 87.838 148 2 3 871 1003 355565162 355565016 3.570000e-35 159.0
38 TraesCS3B01G612400 chrUn 98.077 52 1 0 1082 1133 355565019 355564968 1.320000e-14 91.6
39 TraesCS3B01G612400 chr1B 94.737 95 5 0 778 872 297119607 297119701 7.730000e-32 148.0
40 TraesCS3B01G612400 chr2A 96.552 87 3 0 787 873 762155350 762155264 1.000000e-30 145.0
41 TraesCS3B01G612400 chr2B 93.684 95 5 1 786 879 644847715 644847621 1.290000e-29 141.0
42 TraesCS3B01G612400 chr4A 88.889 108 10 2 774 881 296623853 296623748 7.780000e-27 132.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G612400 chr3B 829816279 829819734 3455 False 6383.0 6383 100.0000 1 3456 1 chr3B.!!$F1 3455
1 TraesCS3B01G612400 chr3B 829935132 829936731 1599 False 2305.0 2305 93.0930 871 2433 1 chr3B.!!$F2 1562
2 TraesCS3B01G612400 chr3B 830610636 830612183 1547 False 2013.0 2013 90.3550 871 2433 1 chr3B.!!$F7 1562
3 TraesCS3B01G612400 chr3B 830454502 830455531 1029 False 1849.0 1849 99.1260 2430 3456 1 chr3B.!!$F6 1026
4 TraesCS3B01G612400 chr3B 830180688 830181877 1189 False 1017.5 1820 98.8985 1 3456 2 chr3B.!!$F10 3455
5 TraesCS3B01G612400 chr3B 829804516 829808705 4189 False 606.0 606 92.2370 122 559 2 chr3B.!!$F8 437
6 TraesCS3B01G612400 chr3B 830150309 830152349 2040 False 319.5 424 96.5765 1 404 2 chr3B.!!$F9 403
7 TraesCS3B01G612400 chrUn 184612760 184616219 3459 False 6320.0 6320 99.6530 1 3456 1 chrUn.!!$F2 3455
8 TraesCS3B01G612400 chrUn 374647322 374649073 1751 True 3088.0 3088 98.5160 1312 3060 1 chrUn.!!$R5 1748
9 TraesCS3B01G612400 chrUn 232412484 232415889 3405 True 3026.5 3919 98.5265 1 3456 2 chrUn.!!$R9 3455
10 TraesCS3B01G612400 chrUn 396854363 396855833 1470 True 2641.0 2641 99.0500 1340 2812 1 chrUn.!!$R7 1472
11 TraesCS3B01G612400 chrUn 202220311 202223087 2776 False 2501.0 3925 99.3505 643 3456 2 chrUn.!!$F8 2813
12 TraesCS3B01G612400 chrUn 410133447 410134784 1337 True 2435.0 2435 99.5520 1340 2674 1 chrUn.!!$R8 1334
13 TraesCS3B01G612400 chrUn 184582349 184583948 1599 False 2311.0 2311 93.1550 871 2433 1 chrUn.!!$F1 1562
14 TraesCS3B01G612400 chrUn 366086613 366088085 1472 True 2254.0 2254 94.1840 871 2365 1 chrUn.!!$R4 1494
15 TraesCS3B01G612400 chrUn 420125290 420126540 1250 False 2217.0 2217 98.6410 1810 3060 1 chrUn.!!$F6 1250
16 TraesCS3B01G612400 chrUn 204468230 204469446 1216 False 2139.0 2139 98.2140 1 1231 1 chrUn.!!$F3 1230
17 TraesCS3B01G612400 chrUn 344796932 344799251 2319 True 2095.5 3114 99.3420 643 2994 2 chrUn.!!$R10 2351
18 TraesCS3B01G612400 chrUn 354627128 354628274 1146 True 2080.0 2080 99.3900 2310 3456 1 chrUn.!!$R3 1146
19 TraesCS3B01G612400 chrUn 392331149 392331726 577 False 1051.0 1051 99.4810 2879 3456 1 chrUn.!!$F4 577
20 TraesCS3B01G612400 chrUn 394685245 394685822 577 False 1051.0 1051 99.4810 2879 3456 1 chrUn.!!$F5 577
21 TraesCS3B01G612400 chrUn 298233468 298233979 511 True 946.0 946 100.0000 1 512 1 chrUn.!!$R1 511

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2227 5355 0.782384 AAATGAAGTCGTCGCGTCAC 59.218 50.0 5.77 0.9 30.41 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3149 6283 6.3445 TCAAGCTTTACAAAATTTGGCTTCA 58.656 32.0 14.08 2.86 36.59 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2227 5355 0.782384 AAATGAAGTCGTCGCGTCAC 59.218 50.0 5.77 0.9 30.41 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2227 5355 2.703416 TGCAGAGCATGTACCAAAGAG 58.297 47.619 0.00 0.00 31.71 2.85
2308 5436 6.783977 ACAACCCATTAATGCATGATAAGGAT 59.216 34.615 10.11 0.00 0.00 3.24
3149 6283 6.344500 TCAAGCTTTACAAAATTTGGCTTCA 58.656 32.000 14.08 2.86 36.59 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.