Multiple sequence alignment - TraesCS3B01G579000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G579000 chr3B 100.000 4379 0 0 1 4379 808447800 808443422 0.000000e+00 8087.0
1 TraesCS3B01G579000 chr3B 99.315 4380 17 2 1 4379 808375160 808370793 0.000000e+00 7910.0
2 TraesCS3B01G579000 chr3B 99.292 4380 23 3 1 4379 808412100 808407728 0.000000e+00 7910.0
3 TraesCS3B01G579000 chr3B 97.755 4365 84 7 1 4354 808392102 808387741 0.000000e+00 7505.0
4 TraesCS3B01G579000 chr3B 98.089 3611 67 2 744 4354 808428332 808424724 0.000000e+00 6285.0
5 TraesCS3B01G579000 chr3B 96.888 739 19 4 1 736 808429284 808428547 0.000000e+00 1234.0
6 TraesCS3B01G579000 chr3B 98.175 274 3 2 1 272 808353980 808353707 1.100000e-130 477.0
7 TraesCS3B01G579000 chr3B 98.540 137 2 0 4243 4379 408314460 408314324 4.380000e-60 243.0
8 TraesCS3B01G579000 chr3B 94.030 67 4 0 565 631 808374552 808374486 7.750000e-18 102.0
9 TraesCS3B01G579000 chr3B 94.030 67 4 0 608 674 808374595 808374529 7.750000e-18 102.0
10 TraesCS3B01G579000 chr3B 94.030 67 4 0 565 631 808411492 808411426 7.750000e-18 102.0
11 TraesCS3B01G579000 chr3B 94.030 67 4 0 608 674 808411535 808411469 7.750000e-18 102.0
12 TraesCS3B01G579000 chr6B 94.793 3476 158 12 778 4245 685548988 685552448 0.000000e+00 5395.0
13 TraesCS3B01G579000 chr6B 96.220 582 21 1 173 753 685548416 685548997 0.000000e+00 952.0
14 TraesCS3B01G579000 chr6B 94.350 177 10 0 1 177 685548120 685548296 5.580000e-69 272.0
15 TraesCS3B01G579000 chr6B 96.721 61 2 0 608 668 685548809 685548869 7.750000e-18 102.0
16 TraesCS3B01G579000 chr6B 94.030 67 4 0 565 631 685548852 685548918 7.750000e-18 102.0
17 TraesCS3B01G579000 chr6D 93.126 2546 158 11 770 3303 451312189 451314729 0.000000e+00 3716.0
18 TraesCS3B01G579000 chr6D 95.034 584 27 2 173 755 451311618 451312200 0.000000e+00 917.0
19 TraesCS3B01G579000 chr6D 94.915 177 9 0 1 177 451311322 451311498 1.200000e-70 278.0
20 TraesCS3B01G579000 chr6D 100.000 29 0 0 413 441 428990387 428990359 2.000000e-03 54.7
21 TraesCS3B01G579000 chr7D 84.112 428 60 6 778 1205 629893183 629893602 1.470000e-109 407.0
22 TraesCS3B01G579000 chr7B 83.991 431 61 6 776 1205 732841082 732841505 1.470000e-109 407.0
23 TraesCS3B01G579000 chr7B 83.759 431 62 5 776 1205 732815952 732816375 6.820000e-108 401.0
24 TraesCS3B01G579000 chr6A 78.360 573 99 18 1271 1830 597025347 597025907 9.010000e-92 348.0
25 TraesCS3B01G579000 chr4D 99.270 137 1 0 4243 4379 54588099 54587963 9.400000e-62 248.0
26 TraesCS3B01G579000 chr5B 98.540 137 2 0 4243 4379 469691472 469691608 4.380000e-60 243.0
27 TraesCS3B01G579000 chr1B 98.540 137 2 0 4243 4379 4505345 4505481 4.380000e-60 243.0
28 TraesCS3B01G579000 chr1B 98.540 137 2 0 4243 4379 524689106 524689242 4.380000e-60 243.0
29 TraesCS3B01G579000 chr1B 95.238 42 2 0 415 456 452309078 452309037 2.830000e-07 67.6
30 TraesCS3B01G579000 chr1D 90.566 53 2 3 407 456 336544276 336544224 2.830000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G579000 chr3B 808443422 808447800 4378 True 8087.000000 8087 100.000000 1 4379 1 chr3B.!!$R4 4378
1 TraesCS3B01G579000 chr3B 808387741 808392102 4361 True 7505.000000 7505 97.755000 1 4354 1 chr3B.!!$R3 4353
2 TraesCS3B01G579000 chr3B 808424724 808429284 4560 True 3759.500000 6285 97.488500 1 4354 2 chr3B.!!$R7 4353
3 TraesCS3B01G579000 chr3B 808370793 808375160 4367 True 2704.666667 7910 95.791667 1 4379 3 chr3B.!!$R5 4378
4 TraesCS3B01G579000 chr3B 808407728 808412100 4372 True 2704.666667 7910 95.784000 1 4379 3 chr3B.!!$R6 4378
5 TraesCS3B01G579000 chr6B 685548120 685552448 4328 False 1364.600000 5395 95.222800 1 4245 5 chr6B.!!$F1 4244
6 TraesCS3B01G579000 chr6D 451311322 451314729 3407 False 1637.000000 3716 94.358333 1 3303 3 chr6D.!!$F1 3302
7 TraesCS3B01G579000 chr6A 597025347 597025907 560 False 348.000000 348 78.360000 1271 1830 1 chr6A.!!$F1 559

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2517 2890 0.725686 CGCCTGCTCAGTTTCATCAG 59.274 55.0 0.0 0.0 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
4076 4452 5.332656 GGAAATTTATCTAGCGACTGAAGCG 60.333 44.0 0.0 0.0 40.04 4.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2517 2890 0.725686 CGCCTGCTCAGTTTCATCAG 59.274 55.000 0.00 0.0 0.0 2.90
4076 4452 6.511929 GCTTTCACGCCTTAAGAGATTATTCC 60.512 42.308 3.36 0.0 0.0 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
539 668 6.261381 TCCAATAATAATTGTCCAACGGCTAC 59.739 38.462 0.00 0.00 40.84 3.58
1542 1900 3.243941 TGGAAAAGGATCGACAAGAACGA 60.244 43.478 0.00 0.00 43.65 3.85
1543 1901 3.064207 TGGAAAAGGATCGACAAGAACG 58.936 45.455 0.00 0.00 0.00 3.95
1786 2153 4.320546 TCTTGGAAATCACCCATCATGT 57.679 40.909 0.00 0.00 33.04 3.21
2517 2890 2.898920 TTAGGATGGCCTGCTGCTGC 62.899 60.000 8.89 8.89 46.45 5.25
4076 4452 5.332656 GGAAATTTATCTAGCGACTGAAGCG 60.333 44.000 0.00 0.00 40.04 4.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.