Multiple sequence alignment - TraesCS3B01G564500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G564500 chr3B 100.000 2231 0 0 1 2231 797591267 797589037 0 4120
1 TraesCS3B01G564500 chr7B 98.030 2233 42 2 1 2231 742991115 742993347 0 3879
2 TraesCS3B01G564500 chr7B 97.986 2234 41 3 1 2231 716877111 716874879 0 3873
3 TraesCS3B01G564500 chr7A 98.030 2233 41 3 1 2231 60280983 60283214 0 3877
4 TraesCS3B01G564500 chr1A 98.030 2233 41 3 1 2231 498689557 498687326 0 3877
5 TraesCS3B01G564500 chrUn 97.896 2234 43 3 1 2231 186206751 186204519 0 3862
6 TraesCS3B01G564500 chr2B 97.627 2233 50 3 1 2231 391162679 391164910 0 3827
7 TraesCS3B01G564500 chr2B 97.532 1661 37 4 574 2231 112843445 112845104 0 2837
8 TraesCS3B01G564500 chr2B 97.246 581 16 0 1 581 112842705 112843285 0 985
9 TraesCS3B01G564500 chr5A 97.541 2237 48 3 1 2231 238821138 238818903 0 3819
10 TraesCS3B01G564500 chr2A 96.235 1620 48 6 618 2231 444322512 444320900 0 2641
11 TraesCS3B01G564500 chr2A 95.358 1228 47 3 1 1218 779637515 779636288 0 1943


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G564500 chr3B 797589037 797591267 2230 True 4120 4120 100.000 1 2231 1 chr3B.!!$R1 2230
1 TraesCS3B01G564500 chr7B 742991115 742993347 2232 False 3879 3879 98.030 1 2231 1 chr7B.!!$F1 2230
2 TraesCS3B01G564500 chr7B 716874879 716877111 2232 True 3873 3873 97.986 1 2231 1 chr7B.!!$R1 2230
3 TraesCS3B01G564500 chr7A 60280983 60283214 2231 False 3877 3877 98.030 1 2231 1 chr7A.!!$F1 2230
4 TraesCS3B01G564500 chr1A 498687326 498689557 2231 True 3877 3877 98.030 1 2231 1 chr1A.!!$R1 2230
5 TraesCS3B01G564500 chrUn 186204519 186206751 2232 True 3862 3862 97.896 1 2231 1 chrUn.!!$R1 2230
6 TraesCS3B01G564500 chr2B 391162679 391164910 2231 False 3827 3827 97.627 1 2231 1 chr2B.!!$F1 2230
7 TraesCS3B01G564500 chr2B 112842705 112845104 2399 False 1911 2837 97.389 1 2231 2 chr2B.!!$F2 2230
8 TraesCS3B01G564500 chr5A 238818903 238821138 2235 True 3819 3819 97.541 1 2231 1 chr5A.!!$R1 2230
9 TraesCS3B01G564500 chr2A 444320900 444322512 1612 True 2641 2641 96.235 618 2231 1 chr2A.!!$R1 1613
10 TraesCS3B01G564500 chr2A 779636288 779637515 1227 True 1943 1943 95.358 1 1218 1 chr2A.!!$R2 1217

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
388 389 0.811281 GGAAGGGGCACGAAGAAATG 59.189 55.0 0.0 0.0 0.0 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1840 2025 0.179004 AAACGACAAGGGATGCACCA 60.179 50.0 7.49 0.0 41.2 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
388 389 0.811281 GGAAGGGGCACGAAGAAATG 59.189 55.000 0.00 0.00 0.00 2.32
639 811 1.141657 GCTGTAATGGATGGCAGAGGA 59.858 52.381 0.00 0.00 0.00 3.71
801 978 2.361438 GTCGACTCGTTATCCCCATCTT 59.639 50.000 8.70 0.00 0.00 2.40
852 1029 1.413808 GGGGAGAGAGTGGAGCCTATT 60.414 57.143 0.00 0.00 0.00 1.73
1054 1231 5.907866 TTTAATCGAAAAGATGGGTTCCC 57.092 39.130 0.12 0.12 40.02 3.97
1078 1255 5.385396 TTTCGTCTCGACAAAGAAAGAAC 57.615 39.130 0.00 0.00 34.89 3.01
1090 1267 7.649306 CGACAAAGAAAGAACCATCTTGAAAAT 59.351 33.333 0.00 0.00 45.19 1.82
1210 1390 1.679032 GGCAACTATCTCCTGCGGTTT 60.679 52.381 0.00 0.00 36.93 3.27
1409 1591 7.465900 TTACTTCATCCTTTCCATATCCCTT 57.534 36.000 0.00 0.00 0.00 3.95
1538 1720 2.517650 AGCGAGATAGGCTTTACTGC 57.482 50.000 0.00 0.00 37.50 4.40
1727 1912 2.180159 ATACGGGCGTGCTTCCTTGT 62.180 55.000 0.00 0.00 0.00 3.16
1772 1957 1.334869 CACCAGAAACTTCGCTTTGCT 59.665 47.619 0.00 0.00 0.00 3.91
1828 2013 4.772886 ATTTACTACTGGGTCCATCACC 57.227 45.455 0.00 0.00 45.97 4.02
1840 2025 3.034635 GTCCATCACCTGTCCAGATACT 58.965 50.000 0.00 0.00 0.00 2.12
1854 2039 2.092753 CAGATACTGGTGCATCCCTTGT 60.093 50.000 0.00 0.00 34.77 3.16
1928 2113 8.777578 TCATTATAGAAAGAACTAGGCCTACA 57.222 34.615 8.91 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
267 268 2.158445 TCCCAACGAAAATGGAAAGGGA 60.158 45.455 0.00 0.00 40.56 4.20
388 389 1.611936 GCTTCTCCCCCACACTTCTTC 60.612 57.143 0.00 0.00 0.00 2.87
549 550 7.656412 TCAAAGGTTTCATGAAATCGAAATCA 58.344 30.769 23.05 6.04 36.56 2.57
599 771 1.741770 GAGCCGTTTCATGAGCGGT 60.742 57.895 29.00 20.47 46.41 5.68
623 795 2.705148 TGGATCCTCTGCCATCCATTA 58.295 47.619 14.23 0.00 43.11 1.90
639 811 2.365617 CAGTGCTTCGGGTACTATGGAT 59.634 50.000 0.00 0.00 38.80 3.41
1054 1231 5.637104 TCTTTCTTTGTCGAGACGAAAAG 57.363 39.130 7.27 8.64 37.72 2.27
1078 1255 4.098501 GGGTTAGGAGCATTTTCAAGATGG 59.901 45.833 0.00 0.00 0.00 3.51
1090 1267 1.481871 CTACGAAGGGGTTAGGAGCA 58.518 55.000 0.00 0.00 0.00 4.26
1114 1291 6.516860 GCAGGTTCGGATCACTTACTATACAT 60.517 42.308 0.00 0.00 0.00 2.29
1210 1390 2.225142 ACTAACAGCTGAGTCCTCTCCA 60.225 50.000 23.35 0.00 39.75 3.86
1321 1503 6.256539 CGATCCATTGGTTCATATAGAATCCG 59.743 42.308 13.00 0.00 36.48 4.18
1409 1591 5.186992 TGATGAGTAAGATCGAACAAGGGAA 59.813 40.000 0.00 0.00 0.00 3.97
1772 1957 3.466836 AGGCTTTGGTTATACCTGGGTA 58.533 45.455 1.70 1.70 39.58 3.69
1840 2025 0.179004 AAACGACAAGGGATGCACCA 60.179 50.000 7.49 0.00 41.20 4.17
1854 2039 1.832719 TTCAGCCGATGGGGAAACGA 61.833 55.000 0.00 0.00 38.47 3.85
1896 2081 9.770097 CCTAGTTCTTTCTATAATGAGCATTCA 57.230 33.333 0.00 0.00 37.81 2.57
1928 2113 1.676248 TGGGGTGCCTGTTTACCTAT 58.324 50.000 0.00 0.00 37.15 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.