Multiple sequence alignment - TraesCS3B01G560000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G560000 chr3B 100.000 3951 0 0 1 3951 793670939 793666989 0.000000e+00 7297
1 TraesCS3B01G560000 chr3B 98.989 3956 35 2 1 3951 793614411 793610456 0.000000e+00 7079
2 TraesCS3B01G560000 chr3B 98.684 3951 47 1 1 3951 793642945 793639000 0.000000e+00 7003
3 TraesCS3B01G560000 chr3B 98.532 3952 55 2 1 3951 793588692 793584743 0.000000e+00 6974
4 TraesCS3B01G560000 chr3B 97.221 3958 103 3 1 3951 793560437 793556480 0.000000e+00 6693
5 TraesCS3B01G560000 chr3B 97.825 3678 78 1 276 3951 793698230 793694553 0.000000e+00 6348
6 TraesCS3B01G560000 chr3B 97.286 3611 91 1 1 3604 793533217 793529607 0.000000e+00 6119
7 TraesCS3B01G560000 chr3B 96.722 3325 108 1 231 3554 793500550 793497226 0.000000e+00 5535
8 TraesCS3B01G560000 chr3B 96.861 2835 86 3 1119 3951 793487365 793484532 0.000000e+00 4739
9 TraesCS3B01G560000 chr3B 97.303 2447 64 2 1506 3951 792451476 792453921 0.000000e+00 4152
10 TraesCS3B01G560000 chr3B 95.103 1511 43 3 2 1505 792448446 792449932 0.000000e+00 2351
11 TraesCS3B01G560000 chr3B 96.617 1005 25 3 34 1031 792501932 792502934 0.000000e+00 1659
12 TraesCS3B01G560000 chr3B 91.971 685 45 3 1 677 792567874 792568556 0.000000e+00 952
13 TraesCS3B01G560000 chr3D 88.525 366 39 1 3452 3814 583866563 583866928 1.300000e-119 440
14 TraesCS3B01G560000 chr3D 90.152 264 18 2 1 257 592324552 592324290 1.760000e-88 337
15 TraesCS3B01G560000 chr3D 89.394 264 20 3 1 257 592244258 592243996 3.810000e-85 326
16 TraesCS3B01G560000 chrUn 95.436 241 10 1 3711 3951 390444436 390444197 2.230000e-102 383
17 TraesCS3B01G560000 chr1A 92.000 75 5 1 3818 3891 461217880 461217806 1.940000e-18 104


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G560000 chr3B 793666989 793670939 3950 True 7297.0 7297 100.000 1 3951 1 chr3B.!!$R8 3950
1 TraesCS3B01G560000 chr3B 793610456 793614411 3955 True 7079.0 7079 98.989 1 3951 1 chr3B.!!$R6 3950
2 TraesCS3B01G560000 chr3B 793639000 793642945 3945 True 7003.0 7003 98.684 1 3951 1 chr3B.!!$R7 3950
3 TraesCS3B01G560000 chr3B 793584743 793588692 3949 True 6974.0 6974 98.532 1 3951 1 chr3B.!!$R5 3950
4 TraesCS3B01G560000 chr3B 793556480 793560437 3957 True 6693.0 6693 97.221 1 3951 1 chr3B.!!$R4 3950
5 TraesCS3B01G560000 chr3B 793694553 793698230 3677 True 6348.0 6348 97.825 276 3951 1 chr3B.!!$R9 3675
6 TraesCS3B01G560000 chr3B 793529607 793533217 3610 True 6119.0 6119 97.286 1 3604 1 chr3B.!!$R3 3603
7 TraesCS3B01G560000 chr3B 793497226 793500550 3324 True 5535.0 5535 96.722 231 3554 1 chr3B.!!$R2 3323
8 TraesCS3B01G560000 chr3B 793484532 793487365 2833 True 4739.0 4739 96.861 1119 3951 1 chr3B.!!$R1 2832
9 TraesCS3B01G560000 chr3B 792448446 792453921 5475 False 3251.5 4152 96.203 2 3951 2 chr3B.!!$F3 3949
10 TraesCS3B01G560000 chr3B 792501932 792502934 1002 False 1659.0 1659 96.617 34 1031 1 chr3B.!!$F1 997
11 TraesCS3B01G560000 chr3B 792567874 792568556 682 False 952.0 952 91.971 1 677 1 chr3B.!!$F2 676

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
53 54 1.901591 CCATTATCCATTGCGCCTCT 58.098 50.000 4.18 0.00 0.0 3.69 F
1090 1105 2.800250 CTCTGCCTCCCACAAAAAGAT 58.200 47.619 0.00 0.00 0.0 2.40 F
2677 4239 4.039245 CAGTTCCACCGGTGAGTCATATAT 59.961 45.833 36.07 8.46 0.0 0.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1414 1429 1.142474 CGCCGACGAAAAAGTACCTT 58.858 50.000 0.0 0.0 43.93 3.50 R
2740 4302 6.561737 TCTATCTAACTCGCTACCATTGAG 57.438 41.667 0.0 0.0 35.85 3.02 R
3624 5187 3.491964 GCACGTACATCTGGTAATGCCTA 60.492 47.826 0.0 0.0 39.07 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 1.901591 CCATTATCCATTGCGCCTCT 58.098 50.000 4.18 0.00 0.00 3.69
1090 1105 2.800250 CTCTGCCTCCCACAAAAAGAT 58.200 47.619 0.00 0.00 0.00 2.40
2266 3827 4.128643 ACTGCACTACTATCGAGTACTCC 58.871 47.826 17.23 0.00 37.10 3.85
2477 4038 5.527951 GCTAAGTTATTTTCTAGCCTGTCCC 59.472 44.000 0.00 0.00 0.00 4.46
2506 4067 4.899352 ACATTCTCTAGCTTTGTGAGGT 57.101 40.909 0.00 0.00 39.87 3.85
2677 4239 4.039245 CAGTTCCACCGGTGAGTCATATAT 59.961 45.833 36.07 8.46 0.00 0.86
2740 4302 5.163478 ACCGTAGACCATGATTACTTACACC 60.163 44.000 0.00 0.00 0.00 4.16
3211 4773 9.295825 TGGATGTTAACAATCTAGTTCACAATT 57.704 29.630 13.23 0.00 38.60 2.32
3311 4874 3.280920 TGGCAACACGGAAAAATGC 57.719 47.368 0.00 0.00 46.17 3.56
3396 4959 4.485024 TCTTAACGATGAGTATCTCCGC 57.515 45.455 0.00 0.00 34.90 5.54
3672 5235 5.245075 AGTTCATCTTAGCTAGATACCAGGC 59.755 44.000 0.00 0.00 41.78 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
558 568 7.972832 TTTTGAATACAGTACAGACGGAAAT 57.027 32.000 0.00 0.00 0.00 2.17
1090 1105 2.313317 GTGGTGGATGGACGAGGTATA 58.687 52.381 0.00 0.00 0.00 1.47
1253 1268 2.279069 CGGTGGAGTCTGTGGCTCT 61.279 63.158 0.00 0.00 33.73 4.09
1360 1375 4.451150 CGGCGGCCTGTGCTAAGA 62.451 66.667 18.34 0.00 37.74 2.10
1414 1429 1.142474 CGCCGACGAAAAAGTACCTT 58.858 50.000 0.00 0.00 43.93 3.50
1652 3210 1.770294 TCTCCAAAACCAAAAGCGGT 58.230 45.000 0.00 0.00 42.71 5.68
2506 4067 8.038944 AGAAGGCGATTACAAACTTATAGAACA 58.961 33.333 0.00 0.00 0.00 3.18
2740 4302 6.561737 TCTATCTAACTCGCTACCATTGAG 57.438 41.667 0.00 0.00 35.85 3.02
3211 4773 7.118723 AGATAAATGGACCAGACAATAAAGCA 58.881 34.615 0.00 0.00 0.00 3.91
3311 4874 3.191371 GCCCAAACTCATAGTGAAGTTGG 59.809 47.826 11.56 11.56 38.83 3.77
3624 5187 3.491964 GCACGTACATCTGGTAATGCCTA 60.492 47.826 0.00 0.00 39.07 3.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.