Multiple sequence alignment - TraesCS3B01G559900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G559900 chr3B 100.000 3952 0 0 1 3952 793614407 793610456 0.000000e+00 7299
1 TraesCS3B01G559900 chr3B 98.988 3952 35 2 1 3952 793670935 793666989 0.000000e+00 7071
2 TraesCS3B01G559900 chr3B 98.710 3952 41 3 1 3952 793642941 793639000 0.000000e+00 7007
3 TraesCS3B01G559900 chr3B 98.634 3953 46 4 1 3952 793588688 793584743 0.000000e+00 6994
4 TraesCS3B01G559900 chr3B 97.422 3956 90 5 4 3952 793560430 793556480 0.000000e+00 6730
5 TraesCS3B01G559900 chr3B 98.098 3681 67 1 272 3952 793698230 793694553 0.000000e+00 6407
6 TraesCS3B01G559900 chr3B 97.479 3609 79 3 4 3605 793533210 793529607 0.000000e+00 6150
7 TraesCS3B01G559900 chr3B 96.877 3330 98 3 227 3555 793500550 793497226 0.000000e+00 5568
8 TraesCS3B01G559900 chr3B 97.146 2838 75 4 1117 3952 793487365 793484532 0.000000e+00 4787
9 TraesCS3B01G559900 chr3B 97.429 2450 58 3 1504 3952 792451476 792453921 0.000000e+00 4170
10 TraesCS3B01G559900 chr3B 95.166 1510 40 4 1 1503 792448449 792449932 0.000000e+00 2353
11 TraesCS3B01G559900 chr3B 96.226 1007 27 4 30 1029 792501932 792502934 0.000000e+00 1639
12 TraesCS3B01G559900 chr3B 91.740 678 46 3 4 673 792567881 792568556 0.000000e+00 933
13 TraesCS3B01G559900 chr3D 88.798 366 38 1 3453 3815 583866563 583866928 2.800000e-121 446
14 TraesCS3B01G559900 chr3D 90.661 257 16 2 4 253 592324545 592324290 6.330000e-88 335
15 TraesCS3B01G559900 chrUn 95.021 241 11 1 3712 3952 390444436 390444197 1.040000e-100 377


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G559900 chr3B 793610456 793614407 3951 True 7299.0 7299 100.0000 1 3952 1 chr3B.!!$R6 3951
1 TraesCS3B01G559900 chr3B 793666989 793670935 3946 True 7071.0 7071 98.9880 1 3952 1 chr3B.!!$R8 3951
2 TraesCS3B01G559900 chr3B 793639000 793642941 3941 True 7007.0 7007 98.7100 1 3952 1 chr3B.!!$R7 3951
3 TraesCS3B01G559900 chr3B 793584743 793588688 3945 True 6994.0 6994 98.6340 1 3952 1 chr3B.!!$R5 3951
4 TraesCS3B01G559900 chr3B 793556480 793560430 3950 True 6730.0 6730 97.4220 4 3952 1 chr3B.!!$R4 3948
5 TraesCS3B01G559900 chr3B 793694553 793698230 3677 True 6407.0 6407 98.0980 272 3952 1 chr3B.!!$R9 3680
6 TraesCS3B01G559900 chr3B 793529607 793533210 3603 True 6150.0 6150 97.4790 4 3605 1 chr3B.!!$R3 3601
7 TraesCS3B01G559900 chr3B 793497226 793500550 3324 True 5568.0 5568 96.8770 227 3555 1 chr3B.!!$R2 3328
8 TraesCS3B01G559900 chr3B 793484532 793487365 2833 True 4787.0 4787 97.1460 1117 3952 1 chr3B.!!$R1 2835
9 TraesCS3B01G559900 chr3B 792448449 792453921 5472 False 3261.5 4170 96.2975 1 3952 2 chr3B.!!$F3 3951
10 TraesCS3B01G559900 chr3B 792501932 792502934 1002 False 1639.0 1639 96.2260 30 1029 1 chr3B.!!$F1 999
11 TraesCS3B01G559900 chr3B 792567881 792568556 675 False 933.0 933 91.7400 4 673 1 chr3B.!!$F2 669

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
398 410 0.669318 TTTCCGACGATGCGCTTTCT 60.669 50.000 9.73 0.00 0.00 2.52 F
1886 3445 1.152368 GCTAGCCCATGGGAGCAAT 59.848 57.895 36.00 15.67 35.81 3.56 F
1887 3446 0.401738 GCTAGCCCATGGGAGCAATA 59.598 55.000 36.00 15.96 35.81 1.90 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1888 3447 8.356657 CCTCAGATTCAACGAGATAGAAGTTAT 58.643 37.037 0.00 0.00 0.00 1.89 R
2886 4446 3.001228 CACACAATGTGTTATCCCGATCG 59.999 47.826 17.31 8.51 45.08 3.69 R
3412 4974 6.496565 AGGGAGGAGTATATCAAATGACTCAG 59.503 42.308 3.54 0.00 40.10 3.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
398 410 0.669318 TTTCCGACGATGCGCTTTCT 60.669 50.000 9.73 0.00 0.00 2.52
604 616 9.535878 AACAAACTTGACAAACACTTTCTTTTA 57.464 25.926 0.00 0.00 0.00 1.52
999 1013 3.386768 AGACGCGCCAAGAATATGTAT 57.613 42.857 5.73 0.00 0.00 2.29
1000 1014 3.059884 AGACGCGCCAAGAATATGTATG 58.940 45.455 5.73 0.00 0.00 2.39
1845 3404 2.009774 GGACAATCTCCATGTTCACCG 58.990 52.381 0.00 0.00 39.21 4.94
1886 3445 1.152368 GCTAGCCCATGGGAGCAAT 59.848 57.895 36.00 15.67 35.81 3.56
1887 3446 0.401738 GCTAGCCCATGGGAGCAATA 59.598 55.000 36.00 15.96 35.81 1.90
1888 3447 1.202927 GCTAGCCCATGGGAGCAATAA 60.203 52.381 36.00 9.24 35.81 1.40
2463 4022 6.067263 TGTTTGATGGTGTTGCTAAGTTAC 57.933 37.500 0.00 0.00 0.00 2.50
2563 4123 6.339587 TCCTCAAACATTATTGGGTTGTTC 57.660 37.500 0.00 0.00 32.66 3.18
2886 4446 7.254852 TGTGCGGGATAGAATTTTGTAATTTC 58.745 34.615 0.00 0.00 34.16 2.17
3412 4974 8.311650 AGTATCTCCGTTAATATTGTTGCATC 57.688 34.615 0.00 0.00 0.00 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 213 7.519032 TGTTAAGAAAAATGGTAGGACCTTG 57.481 36.000 0.00 0.00 39.58 3.61
434 446 6.897259 TTACATTTATGAAGTCACGGTAGC 57.103 37.500 0.00 0.00 0.00 3.58
604 616 0.955428 AAACCATGTGCGCACGAGAT 60.955 50.000 33.22 19.97 0.00 2.75
999 1013 6.676189 TGGATTGGATGGTGGCTATATATACA 59.324 38.462 0.00 0.00 0.00 2.29
1000 1014 7.136822 TGGATTGGATGGTGGCTATATATAC 57.863 40.000 0.00 0.00 0.00 1.47
1887 3446 9.743057 CTCAGATTCAACGAGATAGAAGTTATT 57.257 33.333 0.00 0.00 0.00 1.40
1888 3447 8.356657 CCTCAGATTCAACGAGATAGAAGTTAT 58.643 37.037 0.00 0.00 0.00 1.89
2463 4022 1.672356 CCACGGACAGGCCAGAAAG 60.672 63.158 5.01 0.00 35.94 2.62
2886 4446 3.001228 CACACAATGTGTTATCCCGATCG 59.999 47.826 17.31 8.51 45.08 3.69
3412 4974 6.496565 AGGGAGGAGTATATCAAATGACTCAG 59.503 42.308 3.54 0.00 40.10 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.