Multiple sequence alignment - TraesCS3B01G558100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G558100 chr3B 100.000 2237 0 0 1 2237 792435449 792433213 0.000000e+00 4132.0
1 TraesCS3B01G558100 chr3B 99.732 2237 6 0 1 2237 792345128 792342892 0.000000e+00 4098.0
2 TraesCS3B01G558100 chr3B 99.598 2237 9 0 1 2237 793394762 793396998 0.000000e+00 4082.0
3 TraesCS3B01G558100 chr3B 94.372 231 9 1 1933 2163 464610438 464610212 3.530000e-93 351.0
4 TraesCS3B01G558100 chrUn 99.687 2237 7 0 1 2237 155032230 155034466 0.000000e+00 4093.0
5 TraesCS3B01G558100 chrUn 99.761 418 1 0 1 418 352277696 352277279 0.000000e+00 767.0
6 TraesCS3B01G558100 chr3D 86.659 1649 123 54 215 1836 591104187 591102609 0.000000e+00 1736.0
7 TraesCS3B01G558100 chr3D 92.558 215 12 2 1 215 591120167 591119957 2.790000e-79 305.0
8 TraesCS3B01G558100 chr3D 92.308 78 4 2 2161 2237 591102361 591102285 2.350000e-20 110.0
9 TraesCS3B01G558100 chr3D 83.333 108 13 5 1 104 48542406 48542300 6.580000e-16 95.3
10 TraesCS3B01G558100 chr3D 90.909 66 4 1 32 95 591120171 591120106 1.100000e-13 87.9
11 TraesCS3B01G558100 chr3A 91.405 861 53 8 1 845 721463171 721462316 0.000000e+00 1160.0
12 TraesCS3B01G558100 chr3A 95.736 258 9 2 833 1089 721462181 721461925 4.440000e-112 414.0
13 TraesCS3B01G558100 chr1B 95.238 231 11 0 1933 2163 534657370 534657600 1.260000e-97 366.0
14 TraesCS3B01G558100 chr4B 95.238 231 7 1 1933 2163 418510947 418510721 1.630000e-96 363.0
15 TraesCS3B01G558100 chr7B 94.805 231 8 1 1933 2163 464539917 464539691 7.600000e-95 357.0
16 TraesCS3B01G558100 chr6B 94.372 231 9 1 1933 2163 583189008 583189234 3.530000e-93 351.0
17 TraesCS3B01G558100 chr2B 94.372 231 9 1 1933 2163 475256632 475256406 3.530000e-93 351.0
18 TraesCS3B01G558100 chr2B 82.470 251 32 10 995 1241 680221358 680221600 2.250000e-50 209.0
19 TraesCS3B01G558100 chr2B 76.277 274 51 10 969 1237 680063286 680063550 1.390000e-27 134.0
20 TraesCS3B01G558100 chr2D 79.558 362 51 16 894 1241 567568893 567569245 1.030000e-58 237.0
21 TraesCS3B01G558100 chr2A 80.800 250 38 7 995 1241 707040252 707040494 1.050000e-43 187.0
22 TraesCS3B01G558100 chr2A 78.175 252 40 8 994 1241 706919362 706919602 1.790000e-31 147.0
23 TraesCS3B01G558100 chr1D 87.356 87 10 1 1 86 471948882 471948968 5.080000e-17 99.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G558100 chr3B 792433213 792435449 2236 True 4132 4132 100.0000 1 2237 1 chr3B.!!$R3 2236
1 TraesCS3B01G558100 chr3B 792342892 792345128 2236 True 4098 4098 99.7320 1 2237 1 chr3B.!!$R2 2236
2 TraesCS3B01G558100 chr3B 793394762 793396998 2236 False 4082 4082 99.5980 1 2237 1 chr3B.!!$F1 2236
3 TraesCS3B01G558100 chrUn 155032230 155034466 2236 False 4093 4093 99.6870 1 2237 1 chrUn.!!$F1 2236
4 TraesCS3B01G558100 chr3D 591102285 591104187 1902 True 923 1736 89.4835 215 2237 2 chr3D.!!$R2 2022
5 TraesCS3B01G558100 chr3A 721461925 721463171 1246 True 787 1160 93.5705 1 1089 2 chr3A.!!$R1 1088

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
344 346 6.094193 TCATGTAAGGAGCATGACTATGAG 57.906 41.667 0.0 0.0 45.18 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1569 1744 6.589907 GCGATTGGAAAAGTAAATTTGGACAT 59.41 34.615 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
344 346 6.094193 TCATGTAAGGAGCATGACTATGAG 57.906 41.667 0.0 0.0 45.18 2.90
1569 1744 0.476338 TTTTGGGTCCAGCAGTAGCA 59.524 50.000 0.0 0.0 45.49 3.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1569 1744 6.589907 GCGATTGGAAAAGTAAATTTGGACAT 59.41 34.615 0.0 0.0 0.0 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.