Multiple sequence alignment - TraesCS3B01G557800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G557800 chr3B 100.000 3212 0 0 1 3212 792300041 792303252 0.000000e+00 5932.0
1 TraesCS3B01G557800 chr3B 99.609 2555 9 1 659 3212 792386817 792389371 0.000000e+00 4662.0
2 TraesCS3B01G557800 chr3B 91.392 3125 155 38 150 3186 793370185 793367087 0.000000e+00 4176.0
3 TraesCS3B01G557800 chr3B 99.555 2248 10 0 965 3212 793439092 793436845 0.000000e+00 4096.0
4 TraesCS3B01G557800 chr3B 98.833 600 6 1 1 600 792386220 792386818 0.000000e+00 1068.0
5 TraesCS3B01G557800 chr3B 99.296 142 1 0 1 142 793439244 793439103 1.140000e-64 257.0
6 TraesCS3B01G557800 chrUn 99.569 2555 10 1 659 3212 154993534 154990980 0.000000e+00 4656.0
7 TraesCS3B01G557800 chrUn 99.334 2554 17 0 659 3212 155075707 155073154 0.000000e+00 4623.0
8 TraesCS3B01G557800 chrUn 99.516 1654 8 0 965 2618 308788219 308789872 0.000000e+00 3011.0
9 TraesCS3B01G557800 chrUn 82.585 1981 256 55 903 2854 155025266 155023346 0.000000e+00 1664.0
10 TraesCS3B01G557800 chrUn 98.500 600 8 1 1 600 154994131 154993533 0.000000e+00 1057.0
11 TraesCS3B01G557800 chrUn 98.500 600 8 1 1 600 155076304 155075706 0.000000e+00 1057.0
12 TraesCS3B01G557800 chrUn 98.500 600 8 1 1 600 405500470 405499872 0.000000e+00 1057.0
13 TraesCS3B01G557800 chrUn 99.346 306 1 1 659 963 405499873 405499568 1.300000e-153 553.0
14 TraesCS3B01G557800 chrUn 99.296 142 1 0 1 142 308788067 308788208 1.140000e-64 257.0
15 TraesCS3B01G557800 chrUn 82.609 69 9 2 599 664 49143820 49143752 1.240000e-04 58.4
16 TraesCS3B01G557800 chr3A 92.573 2289 131 17 931 3188 721565497 721567777 0.000000e+00 3249.0
17 TraesCS3B01G557800 chr3A 89.702 369 28 4 235 600 721561414 721561775 2.260000e-126 462.0
18 TraesCS3B01G557800 chr3A 95.408 196 5 3 659 853 721561774 721561966 3.110000e-80 309.0
19 TraesCS3B01G557800 chr3A 90.909 77 7 0 140 216 721559495 721559419 1.580000e-18 104.0
20 TraesCS3B01G557800 chr3D 93.258 1498 55 11 659 2117 591176642 591178132 0.000000e+00 2165.0
21 TraesCS3B01G557800 chr3D 82.819 2107 256 64 903 2979 591124158 591126188 0.000000e+00 1788.0
22 TraesCS3B01G557800 chr3D 90.681 1116 66 12 2102 3188 591178985 591180091 0.000000e+00 1450.0
23 TraesCS3B01G557800 chr3D 90.278 432 30 4 177 600 591176216 591176643 3.620000e-154 555.0
24 TraesCS3B01G557800 chr3D 93.182 44 3 0 623 666 392282114 392282071 7.440000e-07 65.8
25 TraesCS3B01G557800 chr6D 100.000 134 0 0 1 134 296277711 296277844 6.880000e-62 248.0
26 TraesCS3B01G557800 chr6D 100.000 134 0 0 1 134 307873120 307872987 6.880000e-62 248.0
27 TraesCS3B01G557800 chr2D 100.000 134 0 0 1 134 132964167 132964034 6.880000e-62 248.0
28 TraesCS3B01G557800 chr4A 85.507 69 8 1 592 660 141145891 141145957 1.600000e-08 71.3
29 TraesCS3B01G557800 chr5D 93.182 44 3 0 619 662 264493015 264492972 7.440000e-07 65.8
30 TraesCS3B01G557800 chr5B 93.182 44 3 0 620 663 311079327 311079370 7.440000e-07 65.8
31 TraesCS3B01G557800 chr1D 93.182 44 3 0 620 663 328757593 328757550 7.440000e-07 65.8
32 TraesCS3B01G557800 chr7B 84.615 65 7 2 599 660 253866744 253866680 9.620000e-06 62.1
33 TraesCS3B01G557800 chr7D 83.333 66 6 1 599 664 597043667 597043607 4.480000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G557800 chr3B 792300041 792303252 3211 False 5932.0 5932 100.000000 1 3212 1 chr3B.!!$F1 3211
1 TraesCS3B01G557800 chr3B 793367087 793370185 3098 True 4176.0 4176 91.392000 150 3186 1 chr3B.!!$R1 3036
2 TraesCS3B01G557800 chr3B 792386220 792389371 3151 False 2865.0 4662 99.221000 1 3212 2 chr3B.!!$F2 3211
3 TraesCS3B01G557800 chr3B 793436845 793439244 2399 True 2176.5 4096 99.425500 1 3212 2 chr3B.!!$R2 3211
4 TraesCS3B01G557800 chrUn 154990980 154994131 3151 True 2856.5 4656 99.034500 1 3212 2 chrUn.!!$R3 3211
5 TraesCS3B01G557800 chrUn 155073154 155076304 3150 True 2840.0 4623 98.917000 1 3212 2 chrUn.!!$R4 3211
6 TraesCS3B01G557800 chrUn 155023346 155025266 1920 True 1664.0 1664 82.585000 903 2854 1 chrUn.!!$R2 1951
7 TraesCS3B01G557800 chrUn 308788067 308789872 1805 False 1634.0 3011 99.406000 1 2618 2 chrUn.!!$F1 2617
8 TraesCS3B01G557800 chrUn 405499568 405500470 902 True 805.0 1057 98.923000 1 963 2 chrUn.!!$R5 962
9 TraesCS3B01G557800 chr3A 721561414 721567777 6363 False 1340.0 3249 92.561000 235 3188 3 chr3A.!!$F1 2953
10 TraesCS3B01G557800 chr3D 591124158 591126188 2030 False 1788.0 1788 82.819000 903 2979 1 chr3D.!!$F1 2076
11 TraesCS3B01G557800 chr3D 591176216 591180091 3875 False 1390.0 2165 91.405667 177 3188 3 chr3D.!!$F2 3011

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
618 638 1.657804 ACTCCTTCCGTCCCATTCTT 58.342 50.000 0.00 0.0 0.00 2.52 F
1838 5367 2.323580 GCTCAGCTGAGTTTGCGCT 61.324 57.895 37.25 0.0 43.85 5.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2021 5550 1.003438 CGAAGAGTGCTCGATCGATGA 60.003 52.381 19.78 5.11 42.29 2.92 R
2923 7389 2.560981 TCGCCACACTCTTGACATCTTA 59.439 45.455 0.00 0.00 0.00 2.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
136 137 2.158813 GGGCATATTTCCTTCAGTCCGA 60.159 50.000 0.00 0.00 0.00 4.55
409 426 2.691526 ACTAGCCATTCGTATCCGTCAA 59.308 45.455 0.00 0.00 35.01 3.18
458 475 4.332828 CCGAAGAAACCTTATTCCAACCT 58.667 43.478 0.00 0.00 0.00 3.50
583 603 8.383175 TGGTTTAGGTAAGTGAAATCTCTGAAT 58.617 33.333 0.00 0.00 0.00 2.57
592 612 8.715191 AAGTGAAATCTCTGAATCAGTGATAC 57.285 34.615 23.01 18.22 41.75 2.24
615 635 2.700897 CAGATACTCCTTCCGTCCCATT 59.299 50.000 0.00 0.00 0.00 3.16
616 636 2.966516 AGATACTCCTTCCGTCCCATTC 59.033 50.000 0.00 0.00 0.00 2.67
618 638 1.657804 ACTCCTTCCGTCCCATTCTT 58.342 50.000 0.00 0.00 0.00 2.52
1838 5367 2.323580 GCTCAGCTGAGTTTGCGCT 61.324 57.895 37.25 0.00 43.85 5.92
2923 7389 1.889829 GCAGTCTCGTCTATATGGGCT 59.110 52.381 0.00 0.00 0.00 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
267 284 4.141914 ACTTCGACAACTCCTTTCAGTTCT 60.142 41.667 0.00 0.00 34.17 3.01
409 426 3.524789 TCCCACCTTGATGACATCTGATT 59.475 43.478 16.25 0.00 0.00 2.57
583 603 3.821748 AGGAGTATCTGCGTATCACTGA 58.178 45.455 0.00 0.00 33.73 3.41
592 612 0.030908 GGACGGAAGGAGTATCTGCG 59.969 60.000 0.00 0.00 33.73 5.18
652 695 1.264749 TGCCGCATGAACTACTCCCT 61.265 55.000 0.00 0.00 0.00 4.20
824 871 3.419793 TTGGTCCAAGCCAAGTCTG 57.580 52.632 0.00 0.00 42.98 3.51
1838 5367 7.068962 TGGTGATATTATCAGGTTTGACGTCTA 59.931 37.037 17.92 6.32 40.53 2.59
2021 5550 1.003438 CGAAGAGTGCTCGATCGATGA 60.003 52.381 19.78 5.11 42.29 2.92
2518 6953 6.214819 ACAATACCCTGGACTAAACTACATGT 59.785 38.462 2.69 2.69 0.00 3.21
2923 7389 2.560981 TCGCCACACTCTTGACATCTTA 59.439 45.455 0.00 0.00 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.