Multiple sequence alignment - TraesCS3B01G555100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G555100 chr3B 100.000 3802 0 0 1 3802 788983559 788987360 0.000000e+00 7022.0
1 TraesCS3B01G555100 chr3B 99.295 3548 11 1 255 3802 788935631 788939164 0.000000e+00 6401.0
2 TraesCS3B01G555100 chr3B 89.094 2494 174 44 1 2419 789055736 789058206 0.000000e+00 3009.0
3 TraesCS3B01G555100 chr3B 83.082 1324 182 33 1518 2821 789183336 789182035 0.000000e+00 1166.0
4 TraesCS3B01G555100 chr3B 81.919 719 110 12 2442 3142 789058387 789059103 1.180000e-164 590.0
5 TraesCS3B01G555100 chr3B 99.611 257 1 0 1 257 788933693 788933949 1.600000e-128 470.0
6 TraesCS3B01G555100 chr3B 79.434 530 74 20 852 1379 789220096 789220592 3.640000e-90 342.0
7 TraesCS3B01G555100 chr3D 95.119 3032 141 7 441 3469 590092926 590089899 0.000000e+00 4772.0
8 TraesCS3B01G555100 chr3D 88.979 2595 231 32 577 3142 590148225 590150793 0.000000e+00 3157.0
9 TraesCS3B01G555100 chr3D 84.827 1272 163 18 1570 2822 590043008 590044268 0.000000e+00 1253.0
10 TraesCS3B01G555100 chr3D 83.486 1314 174 34 1530 2822 590221819 590220528 0.000000e+00 1184.0
11 TraesCS3B01G555100 chr3D 92.254 426 14 6 1 409 590093350 590092927 1.520000e-163 586.0
12 TraesCS3B01G555100 chr3D 84.016 488 39 14 1 449 590138554 590139041 2.100000e-117 433.0
13 TraesCS3B01G555100 chr3D 78.788 627 94 23 840 1454 590222595 590221996 5.960000e-103 385.0
14 TraesCS3B01G555100 chr3A 88.644 2492 212 49 581 3026 719836958 719839424 0.000000e+00 2968.0
15 TraesCS3B01G555100 chr3A 83.714 1314 171 34 1530 2822 719939588 719938297 0.000000e+00 1201.0
16 TraesCS3B01G555100 chr3A 83.425 1279 182 19 1565 2822 719778529 719779798 0.000000e+00 1160.0
17 TraesCS3B01G555100 chr3A 78.909 678 99 27 840 1501 719940366 719939717 1.630000e-113 420.0
18 TraesCS3B01G555100 chr3A 85.749 407 22 16 1 382 719836415 719836810 7.650000e-107 398.0
19 TraesCS3B01G555100 chr3A 90.496 242 23 0 1110 1351 719777740 719777981 1.700000e-83 320.0
20 TraesCS3B01G555100 chr3A 81.449 345 50 6 2496 2826 720231742 720232086 1.740000e-68 270.0
21 TraesCS3B01G555100 chr3A 80.870 345 52 7 2496 2826 720078423 720078767 3.770000e-65 259.0
22 TraesCS3B01G555100 chrUn 100.000 394 0 0 2979 3372 479425912 479426305 0.000000e+00 728.0
23 TraesCS3B01G555100 chrUn 96.418 335 12 0 3468 3802 102433661 102433995 1.540000e-153 553.0
24 TraesCS3B01G555100 chr6B 97.015 335 10 0 3468 3802 521963852 521964186 7.130000e-157 564.0
25 TraesCS3B01G555100 chr7D 97.289 332 8 1 3472 3802 613964760 613964429 2.560000e-156 562.0
26 TraesCS3B01G555100 chr4D 96.979 331 10 0 3472 3802 298321363 298321033 1.190000e-154 556.0
27 TraesCS3B01G555100 chr6D 96.418 335 12 0 3468 3802 329872222 329871888 1.540000e-153 553.0
28 TraesCS3B01G555100 chr6D 96.418 335 12 0 3468 3802 362798080 362798414 1.540000e-153 553.0
29 TraesCS3B01G555100 chr6D 94.085 355 19 2 3449 3802 249783425 249783072 4.320000e-149 538.0
30 TraesCS3B01G555100 chr6D 86.869 99 9 4 380 476 1548843 1548747 1.440000e-19 108.0
31 TraesCS3B01G555100 chr1D 96.418 335 12 0 3468 3802 436313639 436313973 1.540000e-153 553.0
32 TraesCS3B01G555100 chr6A 86.139 101 11 3 371 469 27725461 27725560 5.190000e-19 106.0
33 TraesCS3B01G555100 chr5A 84.404 109 11 6 363 467 605273961 605274067 6.720000e-18 102.0
34 TraesCS3B01G555100 chr4B 83.929 112 12 6 359 467 134396205 134396313 6.720000e-18 102.0
35 TraesCS3B01G555100 chr7B 83.036 112 15 4 358 467 510433790 510433681 8.690000e-17 99.0
36 TraesCS3B01G555100 chr7A 82.759 116 13 7 359 470 179074288 179074400 3.130000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G555100 chr3B 788983559 788987360 3801 False 7022.0 7022 100.0000 1 3802 1 chr3B.!!$F1 3801
1 TraesCS3B01G555100 chr3B 788933693 788939164 5471 False 3435.5 6401 99.4530 1 3802 2 chr3B.!!$F3 3801
2 TraesCS3B01G555100 chr3B 789055736 789059103 3367 False 1799.5 3009 85.5065 1 3142 2 chr3B.!!$F4 3141
3 TraesCS3B01G555100 chr3B 789182035 789183336 1301 True 1166.0 1166 83.0820 1518 2821 1 chr3B.!!$R1 1303
4 TraesCS3B01G555100 chr3D 590148225 590150793 2568 False 3157.0 3157 88.9790 577 3142 1 chr3D.!!$F3 2565
5 TraesCS3B01G555100 chr3D 590089899 590093350 3451 True 2679.0 4772 93.6865 1 3469 2 chr3D.!!$R1 3468
6 TraesCS3B01G555100 chr3D 590043008 590044268 1260 False 1253.0 1253 84.8270 1570 2822 1 chr3D.!!$F1 1252
7 TraesCS3B01G555100 chr3D 590220528 590222595 2067 True 784.5 1184 81.1370 840 2822 2 chr3D.!!$R2 1982
8 TraesCS3B01G555100 chr3A 719836415 719839424 3009 False 1683.0 2968 87.1965 1 3026 2 chr3A.!!$F4 3025
9 TraesCS3B01G555100 chr3A 719938297 719940366 2069 True 810.5 1201 81.3115 840 2822 2 chr3A.!!$R1 1982
10 TraesCS3B01G555100 chr3A 719777740 719779798 2058 False 740.0 1160 86.9605 1110 2822 2 chr3A.!!$F3 1712

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
29 30 0.390860 CAAGTCCCTAGATGGAGCGG 59.609 60.000 0.0 0.0 38.35 5.52 F
1982 4122 1.270094 CCACAAGCACTCTCGGTTACA 60.270 52.381 0.0 0.0 0.00 2.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1982 4122 5.395768 GCCTTAAGGTCTCTGTGTATGATGT 60.396 44.000 22.55 0.0 37.57 3.06 R
2977 5337 4.154737 TGATGTGATGTTTTCTGCTAGTGC 59.845 41.667 0.00 0.0 40.20 4.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 0.390860 CAAGTCCCTAGATGGAGCGG 59.609 60.000 0.0 0.0 38.35 5.52
1982 4122 1.270094 CCACAAGCACTCTCGGTTACA 60.270 52.381 0.0 0.0 0.00 2.41
2656 4962 0.462581 CCCACCATGTCAGATGTCGG 60.463 60.000 0.0 0.0 0.00 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1982 4122 5.395768 GCCTTAAGGTCTCTGTGTATGATGT 60.396 44.000 22.55 0.0 37.57 3.06
2656 4962 3.058914 ACTCTCGCTGTTTAACATTGCAC 60.059 43.478 9.41 0.0 0.00 4.57
2977 5337 4.154737 TGATGTGATGTTTTCTGCTAGTGC 59.845 41.667 0.00 0.0 40.20 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.