Multiple sequence alignment - TraesCS3B01G549100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G549100 chr3B 100.000 2549 0 0 1 2549 784524266 784526814 0.000000e+00 4708
1 TraesCS3B01G549100 chr3B 99.294 2550 16 2 1 2549 784453129 784455677 0.000000e+00 4608
2 TraesCS3B01G549100 chr3B 98.964 193 2 0 586 778 54505058 54505250 1.880000e-91 346
3 TraesCS3B01G549100 chr3D 90.959 1814 105 25 779 2547 587420695 587422494 0.000000e+00 2386
4 TraesCS3B01G549100 chr3D 95.218 481 12 3 114 585 587420224 587420702 0.000000e+00 750
5 TraesCS3B01G549100 chr3D 96.063 127 5 0 3 129 587398409 587398535 9.240000e-50 207
6 TraesCS3B01G549100 chr7B 79.985 1319 171 48 822 2061 133245822 133244518 0.000000e+00 887
7 TraesCS3B01G549100 chr7B 98.969 194 2 0 585 778 65350103 65350296 5.220000e-92 348
8 TraesCS3B01G549100 chr7B 97.436 195 5 0 584 778 696253235 696253429 1.460000e-87 333
9 TraesCS3B01G549100 chr7B 84.091 220 33 2 2256 2474 133244312 133244094 7.140000e-51 211
10 TraesCS3B01G549100 chr7D 79.833 1319 174 48 822 2061 168069804 168068499 0.000000e+00 878
11 TraesCS3B01G549100 chr7D 83.830 235 36 2 2256 2489 168068294 168068061 3.300000e-54 222
12 TraesCS3B01G549100 chr7A 79.310 1334 184 48 807 2061 170191604 170190284 0.000000e+00 850
13 TraesCS3B01G549100 chr7A 84.000 200 30 2 2276 2474 170190073 170189875 9.310000e-45 191
14 TraesCS3B01G549100 chr3A 99.487 195 1 0 584 778 749184249 749184055 3.120000e-94 355
15 TraesCS3B01G549100 chr1B 95.192 208 8 2 582 787 680813918 680813711 6.800000e-86 327
16 TraesCS3B01G549100 chr1A 94.660 206 11 0 574 779 44328967 44329172 1.140000e-83 320
17 TraesCS3B01G549100 chr4A 93.458 214 11 3 585 798 724226283 724226073 5.290000e-82 315
18 TraesCS3B01G549100 chr2B 93.427 213 13 1 574 786 47079937 47080148 5.290000e-82 315


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G549100 chr3B 784524266 784526814 2548 False 4708.0 4708 100.0000 1 2549 1 chr3B.!!$F3 2548
1 TraesCS3B01G549100 chr3B 784453129 784455677 2548 False 4608.0 4608 99.2940 1 2549 1 chr3B.!!$F2 2548
2 TraesCS3B01G549100 chr3D 587420224 587422494 2270 False 1568.0 2386 93.0885 114 2547 2 chr3D.!!$F2 2433
3 TraesCS3B01G549100 chr7B 133244094 133245822 1728 True 549.0 887 82.0380 822 2474 2 chr7B.!!$R1 1652
4 TraesCS3B01G549100 chr7D 168068061 168069804 1743 True 550.0 878 81.8315 822 2489 2 chr7D.!!$R1 1667
5 TraesCS3B01G549100 chr7A 170189875 170191604 1729 True 520.5 850 81.6550 807 2474 2 chr7A.!!$R1 1667

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
683 693 7.20141 GCTATAGCGCGCTATTTAGAATGTTTA 60.201 37.037 46.76 28.29 39.65 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1733 1797 1.149148 GAGAACTGTTGAAGACGGGC 58.851 55.0 0.0 0.0 39.05 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
683 693 7.201410 GCTATAGCGCGCTATTTAGAATGTTTA 60.201 37.037 46.76 28.29 39.65 2.01
1464 1503 0.255890 ACTGCCTTGTTCACCTGTGT 59.744 50.000 0.00 0.00 0.00 3.72
1733 1797 1.996786 GATGGCTGTGATGGTTGGCG 61.997 60.000 0.00 0.00 0.00 5.69
2187 2330 8.528044 TGTCCTAATAAACAAAAGAAACACCT 57.472 30.769 0.00 0.00 0.00 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
750 760 5.699458 TGTTTTAAATAGCCCGCTATAGCTC 59.301 40.000 21.98 11.04 40.56 4.09
769 779 9.965902 ATATTCAGAAGTATCTTCCACTGTTTT 57.034 29.630 5.97 0.00 32.03 2.43
1464 1503 2.225791 ATAGCGCGCACCTCTCACAA 62.226 55.000 35.10 5.06 0.00 3.33
1586 1633 9.668497 AAGTTAGTATTTTAGTCATCAAGGGAC 57.332 33.333 0.00 0.00 35.50 4.46
1733 1797 1.149148 GAGAACTGTTGAAGACGGGC 58.851 55.000 0.00 0.00 39.05 6.13
2187 2330 4.355588 TCCTCTGGATTAAACCTTTTCCCA 59.644 41.667 3.17 0.00 0.00 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.