Multiple sequence alignment - TraesCS3B01G548900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G548900 chr3B 100.000 2550 0 0 1 2550 784453128 784455677 0.000000e+00 4710
1 TraesCS3B01G548900 chr3B 99.294 2551 16 2 1 2550 784524265 784526814 0.000000e+00 4610
2 TraesCS3B01G548900 chr3B 98.446 193 2 1 587 778 54505058 54505250 3.140000e-89 339
3 TraesCS3B01G548900 chr3D 90.799 1815 107 25 779 2548 587420695 587422494 0.000000e+00 2372
4 TraesCS3B01G548900 chr3D 95.010 481 13 5 115 586 587420224 587420702 0.000000e+00 745
5 TraesCS3B01G548900 chr3D 95.385 130 6 0 1 130 587398406 587398535 9.250000e-50 207
6 TraesCS3B01G548900 chr7B 79.833 1319 174 53 822 2062 133245822 133244518 0.000000e+00 878
7 TraesCS3B01G548900 chr7B 98.454 194 2 1 586 778 65350103 65350296 8.740000e-90 340
8 TraesCS3B01G548900 chr7B 97.949 195 3 1 585 778 696253235 696253429 1.130000e-88 337
9 TraesCS3B01G548900 chr7B 84.091 220 33 2 2257 2475 133244312 133244094 7.150000e-51 211
10 TraesCS3B01G548900 chr7D 79.682 1319 177 53 822 2062 168069804 168068499 0.000000e+00 867
11 TraesCS3B01G548900 chr7D 83.830 235 36 2 2257 2490 168068294 168068061 3.300000e-54 222
12 TraesCS3B01G548900 chr7A 79.385 1334 184 53 807 2062 170191604 170190284 0.000000e+00 856
13 TraesCS3B01G548900 chr7A 84.000 200 30 2 2277 2475 170190073 170189875 9.310000e-45 191
14 TraesCS3B01G548900 chr3A 98.974 195 1 1 585 778 749184249 749184055 5.220000e-92 348
15 TraesCS3B01G548900 chr2A 96.465 198 6 1 583 779 18860414 18860611 2.450000e-85 326
16 TraesCS3B01G548900 chr1B 94.712 208 8 3 583 787 680813918 680813711 1.140000e-83 320
17 TraesCS3B01G548900 chr2B 93.427 213 12 2 575 786 47079937 47080148 5.300000e-82 315
18 TraesCS3B01G548900 chr1A 94.175 206 11 1 575 779 44328967 44329172 1.900000e-81 313


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G548900 chr3B 784453128 784455677 2549 False 4710.0 4710 100.0000 1 2550 1 chr3B.!!$F2 2549
1 TraesCS3B01G548900 chr3B 784524265 784526814 2549 False 4610.0 4610 99.2940 1 2550 1 chr3B.!!$F3 2549
2 TraesCS3B01G548900 chr3D 587420224 587422494 2270 False 1558.5 2372 92.9045 115 2548 2 chr3D.!!$F2 2433
3 TraesCS3B01G548900 chr7B 133244094 133245822 1728 True 544.5 878 81.9620 822 2475 2 chr7B.!!$R1 1653
4 TraesCS3B01G548900 chr7D 168068061 168069804 1743 True 544.5 867 81.7560 822 2490 2 chr7D.!!$R1 1668
5 TraesCS3B01G548900 chr7A 170189875 170191604 1729 True 523.5 856 81.6925 807 2475 2 chr7A.!!$R1 1668

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
684 694 3.940303 AGCGCGCTATTTAGAATGTTTG 58.06 40.909 35.79 0.0 0.0 2.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2188 2330 4.606255 TCCTCTGGATTAAACCTTTTCCCT 59.394 41.667 3.17 0.0 0.0 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
423 433 5.139435 CTGATCGAGCATAGGATTTACCA 57.861 43.478 2.72 0.00 42.04 3.25
684 694 3.940303 AGCGCGCTATTTAGAATGTTTG 58.060 40.909 35.79 0.00 0.00 2.93
866 877 5.770663 GGAATCTACTGTGAGCAGATACCTA 59.229 44.000 1.30 0.00 45.28 3.08
1060 1077 0.247460 AGATTGCAGCAGCTGTACGA 59.753 50.000 23.60 8.27 42.74 3.43
1394 1432 4.390909 GGAACTGGTTGTATTCTTGTACCG 59.609 45.833 0.00 0.00 0.00 4.02
1753 1816 2.547218 GCACCCGTCTTCAACAGTTCTA 60.547 50.000 0.00 0.00 0.00 2.10
2188 2330 8.294954 TGTCCTAATAAACAAAAGAAACACCA 57.705 30.769 0.00 0.00 0.00 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
423 433 3.565307 TGTTCTGCTGGATTGTTCCTTT 58.435 40.909 0.00 0.00 43.07 3.11
684 694 9.750125 AAGAGACTTTGATCCAAACAAATTAAC 57.250 29.630 0.00 0.00 36.79 2.01
751 761 5.617252 TGTTTAAATAGCCCGCTATAGCTT 58.383 37.500 21.98 10.26 40.56 3.74
866 877 4.497340 CGCGTATCAATGCCCTTTGTTTAT 60.497 41.667 0.00 0.00 33.82 1.40
1906 1997 8.445493 GCAAAAACAATTTTATAGCTTGCTCAT 58.555 29.630 0.00 0.00 36.62 2.90
2188 2330 4.606255 TCCTCTGGATTAAACCTTTTCCCT 59.394 41.667 3.17 0.00 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.