Multiple sequence alignment - TraesCS3B01G545200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G545200 chr3B 100.000 4348 0 0 1 4348 782298969 782294622 0.000000e+00 8030
1 TraesCS3B01G545200 chr3B 99.426 4353 20 3 1 4348 782215748 782211396 0.000000e+00 7895
2 TraesCS3B01G545200 chr3B 99.128 4359 27 4 1 4348 782257157 782252799 0.000000e+00 7829
3 TraesCS3B01G545200 chr3B 98.921 4357 35 5 3 4348 782174653 782170298 0.000000e+00 7775
4 TraesCS3B01G545200 chr5A 95.793 2187 50 20 1779 3956 457099661 457101814 0.000000e+00 3491
5 TraesCS3B01G545200 chr5A 98.098 1788 25 6 3 1783 457097846 457099631 0.000000e+00 3105
6 TraesCS3B01G545200 chr5A 87.423 485 52 7 2197 2675 390558240 390558721 2.290000e-152 549
7 TraesCS3B01G545200 chr5A 85.600 250 35 1 1779 2028 390557608 390557856 1.200000e-65 261
8 TraesCS3B01G545200 chr7B 95.750 2188 50 21 1779 3957 505221664 505219511 0.000000e+00 3485
9 TraesCS3B01G545200 chr7B 98.098 1788 24 7 3 1783 505223478 505221694 0.000000e+00 3105
10 TraesCS3B01G545200 chr2A 88.874 2211 171 34 1779 3959 21632184 21634349 0.000000e+00 2651
11 TraesCS3B01G545200 chr2A 85.600 250 35 1 1779 2028 180214098 180213850 1.200000e-65 261
12 TraesCS3B01G545200 chr5D 97.991 1394 20 5 3 1390 468181193 468179802 0.000000e+00 2412
13 TraesCS3B01G545200 chr5D 98.601 143 2 0 2001 2143 468179801 468179659 2.010000e-63 254
14 TraesCS3B01G545200 chr4B 97.991 1394 20 5 3 1390 42254018 42255409 0.000000e+00 2412
15 TraesCS3B01G545200 chr4B 97.774 1168 25 1 2790 3957 42255569 42256735 0.000000e+00 2012
16 TraesCS3B01G545200 chr4B 98.601 143 2 0 2001 2143 42255410 42255552 2.010000e-63 254
17 TraesCS3B01G545200 chr4A 97.724 1406 25 2 2557 3956 27194815 27193411 0.000000e+00 2412
18 TraesCS3B01G545200 chr4A 90.608 1810 132 21 2163 3955 698013234 698011446 0.000000e+00 2366
19 TraesCS3B01G545200 chr7D 97.980 1386 20 5 3 1382 64827902 64826519 0.000000e+00 2398
20 TraesCS3B01G545200 chr3D 97.980 1386 20 5 3 1382 562177601 562176218 0.000000e+00 2398
21 TraesCS3B01G545200 chr3D 97.854 1165 24 1 2793 3957 562176038 562174875 0.000000e+00 2012
22 TraesCS3B01G545200 chr3D 92.523 214 10 2 4141 4348 585878463 585878250 7.070000e-78 302
23 TraesCS3B01G545200 chr3D 95.858 169 7 0 3962 4130 585878701 585878533 1.540000e-69 274
24 TraesCS3B01G545200 chr4D 97.854 1165 24 1 2793 3957 505348746 505347583 0.000000e+00 2012
25 TraesCS3B01G545200 chr4D 98.601 143 2 0 2001 2143 505348908 505348766 2.010000e-63 254
26 TraesCS3B01G545200 chr7A 87.010 485 54 7 2197 2675 31809315 31809796 4.950000e-149 538
27 TraesCS3B01G545200 chr7A 84.800 250 37 1 1779 2028 31808813 31809061 2.600000e-62 250
28 TraesCS3B01G545200 chr3A 86.000 250 34 1 1779 2028 583077817 583078065 2.580000e-67 267
29 TraesCS3B01G545200 chr6B 85.200 250 36 1 1779 2028 532352025 532352273 5.580000e-64 255


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G545200 chr3B 782294622 782298969 4347 True 8030.000000 8030 100.0000 1 4348 1 chr3B.!!$R4 4347
1 TraesCS3B01G545200 chr3B 782211396 782215748 4352 True 7895.000000 7895 99.4260 1 4348 1 chr3B.!!$R2 4347
2 TraesCS3B01G545200 chr3B 782252799 782257157 4358 True 7829.000000 7829 99.1280 1 4348 1 chr3B.!!$R3 4347
3 TraesCS3B01G545200 chr3B 782170298 782174653 4355 True 7775.000000 7775 98.9210 3 4348 1 chr3B.!!$R1 4345
4 TraesCS3B01G545200 chr5A 457097846 457101814 3968 False 3298.000000 3491 96.9455 3 3956 2 chr5A.!!$F2 3953
5 TraesCS3B01G545200 chr5A 390557608 390558721 1113 False 405.000000 549 86.5115 1779 2675 2 chr5A.!!$F1 896
6 TraesCS3B01G545200 chr7B 505219511 505223478 3967 True 3295.000000 3485 96.9240 3 3957 2 chr7B.!!$R1 3954
7 TraesCS3B01G545200 chr2A 21632184 21634349 2165 False 2651.000000 2651 88.8740 1779 3959 1 chr2A.!!$F1 2180
8 TraesCS3B01G545200 chr5D 468179659 468181193 1534 True 1333.000000 2412 98.2960 3 2143 2 chr5D.!!$R1 2140
9 TraesCS3B01G545200 chr4B 42254018 42256735 2717 False 1559.333333 2412 98.1220 3 3957 3 chr4B.!!$F1 3954
10 TraesCS3B01G545200 chr4A 27193411 27194815 1404 True 2412.000000 2412 97.7240 2557 3956 1 chr4A.!!$R1 1399
11 TraesCS3B01G545200 chr4A 698011446 698013234 1788 True 2366.000000 2366 90.6080 2163 3955 1 chr4A.!!$R2 1792
12 TraesCS3B01G545200 chr7D 64826519 64827902 1383 True 2398.000000 2398 97.9800 3 1382 1 chr7D.!!$R1 1379
13 TraesCS3B01G545200 chr3D 562174875 562177601 2726 True 2205.000000 2398 97.9170 3 3957 2 chr3D.!!$R1 3954
14 TraesCS3B01G545200 chr4D 505347583 505348908 1325 True 1133.000000 2012 98.2275 2001 3957 2 chr4D.!!$R1 1956
15 TraesCS3B01G545200 chr7A 31808813 31809796 983 False 394.000000 538 85.9050 1779 2675 2 chr7A.!!$F1 896

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
59 60 7.959152 TCCCCTTATGGATGTATGTATTGTAGA 59.041 37.037 0.00 0.0 35.39 2.59 F
1499 1516 3.068873 GTGCAACATGGTTGTAGGGAAAA 59.931 43.478 10.44 0.0 34.06 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1783 1835 1.460255 CTCCTTGGGAGGTTGGCAA 59.540 57.895 0.0 0.0 45.43 4.52 R
3386 3736 1.134220 CCCATGCTCCTAGCGGTAAAA 60.134 52.381 0.0 0.0 46.26 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 8.146053 TCCCCTTATGGATGTATGTATTGTAG 57.854 38.462 0.00 0.00 35.39 2.74
59 60 7.959152 TCCCCTTATGGATGTATGTATTGTAGA 59.041 37.037 0.00 0.00 35.39 2.59
1499 1516 3.068873 GTGCAACATGGTTGTAGGGAAAA 59.931 43.478 10.44 0.00 34.06 2.29
1783 1835 8.538701 TGCACAATTGGATATTAGAAAATGGTT 58.461 29.630 10.83 0.00 0.00 3.67
2795 3145 0.392193 CTGACCAGTCCCATGCTGAC 60.392 60.000 5.68 5.68 36.12 3.51
3293 3643 2.711547 ACAGTGGGTCCTTAGCTTCTTT 59.288 45.455 0.00 0.00 0.00 2.52
3386 3736 2.519013 AGAGATTGCGGCTTCCTTTTT 58.481 42.857 0.00 0.00 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 6.292923 TCAGATCTAGCAAGTAGTACCTCTC 58.707 44.000 0.00 0.0 0.00 3.20
59 60 6.100569 TCTCAGATCTAGCAAGTAGTACCTCT 59.899 42.308 0.00 0.0 0.00 3.69
1783 1835 1.460255 CTCCTTGGGAGGTTGGCAA 59.540 57.895 0.00 0.0 45.43 4.52
2795 3145 3.043713 TCAGTTGCAAGCGAGCCG 61.044 61.111 0.00 0.0 0.00 5.52
3293 3643 1.691976 TCTTCTTGAAACCGAGGCTCA 59.308 47.619 15.95 0.0 0.00 4.26
3386 3736 1.134220 CCCATGCTCCTAGCGGTAAAA 60.134 52.381 0.00 0.0 46.26 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.