Multiple sequence alignment - TraesCS3B01G545100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G545100 chr3B 100.000 3374 0 0 1 3374 782256280 782252907 0.000000e+00 6231
1 TraesCS3B01G545100 chr3B 99.140 3374 23 1 1 3374 782214871 782211504 0.000000e+00 6065
2 TraesCS3B01G545100 chr3B 99.081 3374 21 3 1 3374 782298093 782294730 0.000000e+00 6050
3 TraesCS3B01G545100 chr3B 99.022 3374 32 1 1 3374 782173778 782170406 0.000000e+00 6047
4 TraesCS3B01G545100 chr5A 95.930 2187 53 19 904 3087 457099661 457101814 0.000000e+00 3513
5 TraesCS3B01G545100 chr5A 98.680 909 11 1 1 908 457098723 457099631 0.000000e+00 1611
6 TraesCS3B01G545100 chr5A 86.804 485 55 7 1322 1800 390558240 390558721 1.780000e-147 532
7 TraesCS3B01G545100 chr5A 86.000 250 34 1 904 1153 390557608 390557856 2.000000e-67 267
8 TraesCS3B01G545100 chr7B 95.887 2188 53 20 904 3088 505221664 505219511 0.000000e+00 3507
9 TraesCS3B01G545100 chr7B 98.680 909 11 1 1 908 505222602 505221694 0.000000e+00 1611
10 TraesCS3B01G545100 chr2A 89.145 2211 171 30 904 3090 21632184 21634349 0.000000e+00 2689
11 TraesCS3B01G545100 chr2A 92.079 909 70 2 1 908 180215035 180214128 0.000000e+00 1279
12 TraesCS3B01G545100 chr2A 86.000 250 34 1 904 1153 180214098 180213850 2.000000e-67 267
13 TraesCS3B01G545100 chr4A 97.795 1406 30 1 1682 3087 27194815 27193411 0.000000e+00 2423
14 TraesCS3B01G545100 chr4A 90.718 1810 136 17 1288 3086 698013234 698011446 0.000000e+00 2383
15 TraesCS3B01G545100 chr4D 97.597 1165 27 1 1924 3088 505348746 505347583 0.000000e+00 1995
16 TraesCS3B01G545100 chr4D 98.601 143 2 0 1126 1268 505348908 505348766 1.550000e-63 254
17 TraesCS3B01G545100 chr4B 97.517 1168 28 1 1921 3088 42255569 42256735 0.000000e+00 1995
18 TraesCS3B01G545100 chr4B 98.601 143 2 0 1126 1268 42255410 42255552 1.550000e-63 254
19 TraesCS3B01G545100 chr3D 97.597 1165 27 1 1924 3088 562176038 562174875 0.000000e+00 1995
20 TraesCS3B01G545100 chr3D 95.506 178 8 0 3087 3264 585878710 585878533 5.510000e-73 285
21 TraesCS3B01G545100 chr3D 95.098 102 3 1 3275 3374 585878463 585878362 3.480000e-35 159
22 TraesCS3B01G545100 chr6B 91.859 909 72 2 1 908 532351088 532351995 0.000000e+00 1267
23 TraesCS3B01G545100 chr6B 85.600 250 35 1 904 1153 532352025 532352273 9.290000e-66 261
24 TraesCS3B01G545100 chr7A 91.749 909 73 2 1 908 31807876 31808783 0.000000e+00 1262
25 TraesCS3B01G545100 chr7A 86.392 485 57 7 1322 1800 31809315 31809796 3.860000e-144 521
26 TraesCS3B01G545100 chr7A 85.200 250 36 1 904 1153 31808813 31809061 4.320000e-64 255
27 TraesCS3B01G545100 chr6A 91.749 909 73 2 1 908 9184242 9185149 0.000000e+00 1262
28 TraesCS3B01G545100 chr3A 86.400 250 33 1 904 1153 583077817 583078065 4.290000e-69 272
29 TraesCS3B01G545100 chr5D 98.601 143 2 0 1126 1268 468179801 468179659 1.550000e-63 254


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G545100 chr3B 782252907 782256280 3373 True 6231.000000 6231 100.000000 1 3374 1 chr3B.!!$R3 3373
1 TraesCS3B01G545100 chr3B 782211504 782214871 3367 True 6065.000000 6065 99.140000 1 3374 1 chr3B.!!$R2 3373
2 TraesCS3B01G545100 chr3B 782294730 782298093 3363 True 6050.000000 6050 99.081000 1 3374 1 chr3B.!!$R4 3373
3 TraesCS3B01G545100 chr3B 782170406 782173778 3372 True 6047.000000 6047 99.022000 1 3374 1 chr3B.!!$R1 3373
4 TraesCS3B01G545100 chr5A 457098723 457101814 3091 False 2562.000000 3513 97.305000 1 3087 2 chr5A.!!$F2 3086
5 TraesCS3B01G545100 chr5A 390557608 390558721 1113 False 399.500000 532 86.402000 904 1800 2 chr5A.!!$F1 896
6 TraesCS3B01G545100 chr7B 505219511 505222602 3091 True 2559.000000 3507 97.283500 1 3088 2 chr7B.!!$R1 3087
7 TraesCS3B01G545100 chr2A 21632184 21634349 2165 False 2689.000000 2689 89.145000 904 3090 1 chr2A.!!$F1 2186
8 TraesCS3B01G545100 chr2A 180213850 180215035 1185 True 773.000000 1279 89.039500 1 1153 2 chr2A.!!$R1 1152
9 TraesCS3B01G545100 chr4A 27193411 27194815 1404 True 2423.000000 2423 97.795000 1682 3087 1 chr4A.!!$R1 1405
10 TraesCS3B01G545100 chr4A 698011446 698013234 1788 True 2383.000000 2383 90.718000 1288 3086 1 chr4A.!!$R2 1798
11 TraesCS3B01G545100 chr4D 505347583 505348908 1325 True 1124.500000 1995 98.099000 1126 3088 2 chr4D.!!$R1 1962
12 TraesCS3B01G545100 chr4B 42255410 42256735 1325 False 1124.500000 1995 98.059000 1126 3088 2 chr4B.!!$F1 1962
13 TraesCS3B01G545100 chr3D 562174875 562176038 1163 True 1995.000000 1995 97.597000 1924 3088 1 chr3D.!!$R1 1164
14 TraesCS3B01G545100 chr6B 532351088 532352273 1185 False 764.000000 1267 88.729500 1 1153 2 chr6B.!!$F1 1152
15 TraesCS3B01G545100 chr7A 31807876 31809796 1920 False 679.333333 1262 87.780333 1 1800 3 chr7A.!!$F1 1799
16 TraesCS3B01G545100 chr6A 9184242 9185149 907 False 1262.000000 1262 91.749000 1 908 1 chr6A.!!$F1 907

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
737 739 3.057806 CCCATGAACCAACTACGGAAAAC 60.058 47.826 0.0 0.0 0.00 2.43 F
1760 2024 9.784376 ATGAAAATAGGTGGATAGGCTACTATA 57.216 33.333 0.0 0.0 39.97 1.31 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1979 2247 2.125350 CCCTCACTTCCTCGCTGC 60.125 66.667 0.00 0.0 0.0 5.25 R
3271 3553 4.082787 GGAACTGAATCTGAAATTCGGCAA 60.083 41.667 6.52 0.0 37.8 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
709 711 5.099575 GCGTTACCACCTAAATGAATTTGG 58.900 41.667 0.00 0.00 0.00 3.28
737 739 3.057806 CCCATGAACCAACTACGGAAAAC 60.058 47.826 0.00 0.00 0.00 2.43
1760 2024 9.784376 ATGAAAATAGGTGGATAGGCTACTATA 57.216 33.333 0.00 0.00 39.97 1.31
1979 2247 6.148976 GTCAATGTGGATGATGATAGTGATGG 59.851 42.308 0.00 0.00 0.00 3.51
2301 2569 2.949177 AGCGGATAAATGCCCATACA 57.051 45.000 0.00 0.00 0.00 2.29
2373 2641 7.201884 CCAGACCAAGATATCTTCCGTAGTTAA 60.202 40.741 15.24 0.00 33.11 2.01
3271 3553 8.784994 CATCGATGTGTACTAGTACTAGGAATT 58.215 37.037 29.05 13.88 37.49 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
709 711 0.112412 AGTTGGTTCATGGGGTCCAC 59.888 55.000 0.00 0.00 35.80 4.02
737 739 4.875544 ATGACGGTGGTTGAATAATTCG 57.124 40.909 0.00 0.00 0.00 3.34
1755 2019 9.944079 ATAGGAAGCACATATATGGACTATAGT 57.056 33.333 16.96 4.68 0.00 2.12
1760 2024 6.025539 TGGATAGGAAGCACATATATGGACT 58.974 40.000 16.96 10.28 0.00 3.85
1979 2247 2.125350 CCCTCACTTCCTCGCTGC 60.125 66.667 0.00 0.00 0.00 5.25
2301 2569 6.768381 GCTCAAGTTTATCCTTAGCTGGTATT 59.232 38.462 0.00 0.00 0.00 1.89
2373 2641 7.392673 AGAATTGTTTCATCAGCATAGTTGAGT 59.607 33.333 0.00 0.00 34.08 3.41
2751 3027 4.624024 AGCATGCATTTTCAGAAATTGACG 59.376 37.500 21.98 8.64 34.94 4.35
2827 3105 7.751768 TCAGACACTACCTCACATATATCAG 57.248 40.000 0.00 0.00 0.00 2.90
3271 3553 4.082787 GGAACTGAATCTGAAATTCGGCAA 60.083 41.667 6.52 0.00 37.80 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.