Multiple sequence alignment - TraesCS3B01G539700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G539700 chr3B 100.000 2548 0 0 1 2548 778876110 778873563 0.000000e+00 4706.0
1 TraesCS3B01G539700 chr3B 97.410 2548 50 5 1 2548 778932836 778930305 0.000000e+00 4325.0
2 TraesCS3B01G539700 chr3B 89.959 1972 175 16 581 2548 124560191 124558239 0.000000e+00 2523.0
3 TraesCS3B01G539700 chr3B 90.005 1961 172 16 581 2537 124502329 124500389 0.000000e+00 2514.0
4 TraesCS3B01G539700 chr3B 90.142 1755 152 12 581 2331 124399476 124397739 0.000000e+00 2263.0
5 TraesCS3B01G539700 chr3B 96.029 277 10 1 1 276 778705217 778704941 1.390000e-122 449.0
6 TraesCS3B01G539700 chr3B 88.254 315 26 8 281 585 778703882 778703569 1.440000e-97 366.0
7 TraesCS3B01G539700 chr3B 80.000 260 50 2 2 260 778454068 778453810 9.300000e-45 191.0
8 TraesCS3B01G539700 chr3B 76.154 260 51 8 3 258 779525257 779525005 2.660000e-25 126.0
9 TraesCS3B01G539700 chr2D 90.469 1983 161 15 578 2548 12544107 12542141 0.000000e+00 2590.0
10 TraesCS3B01G539700 chr2D 90.232 1986 164 22 571 2546 590929812 590927847 0.000000e+00 2566.0
11 TraesCS3B01G539700 chr6A 89.506 1982 188 12 579 2548 574946044 574944071 0.000000e+00 2490.0
12 TraesCS3B01G539700 chr2B 88.973 1977 177 21 580 2548 540525731 540527674 0.000000e+00 2405.0
13 TraesCS3B01G539700 chr5D 89.041 1898 174 23 585 2471 257136361 257138235 0.000000e+00 2322.0
14 TraesCS3B01G539700 chr5D 91.048 1698 126 16 846 2538 353835367 353833691 0.000000e+00 2270.0
15 TraesCS3B01G539700 chr3A 89.588 1748 158 15 579 2321 47284897 47286625 0.000000e+00 2198.0
16 TraesCS3B01G539700 chr3A 78.358 134 16 7 3 128 625405759 625405631 9.780000e-10 75.0
17 TraesCS3B01G539700 chr6D 89.767 1632 120 25 581 2200 25857863 25859459 0.000000e+00 2045.0
18 TraesCS3B01G539700 chr4B 88.483 1641 156 18 924 2548 35634874 35636497 0.000000e+00 1953.0
19 TraesCS3B01G539700 chrUn 90.768 1354 91 23 1216 2548 110637312 110638652 0.000000e+00 1777.0
20 TraesCS3B01G539700 chr3D 79.845 258 50 2 3 259 582828438 582828694 1.200000e-43 187.0
21 TraesCS3B01G539700 chr3D 78.879 232 42 5 2 229 582056584 582056812 1.580000e-32 150.0
22 TraesCS3B01G539700 chr3D 93.750 64 4 0 133 196 582223472 582223535 2.090000e-16 97.1
23 TraesCS3B01G539700 chr3D 78.358 134 16 8 3 128 482501625 482501497 9.780000e-10 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G539700 chr3B 778873563 778876110 2547 True 4706.0 4706 100.0000 1 2548 1 chr3B.!!$R5 2547
1 TraesCS3B01G539700 chr3B 778930305 778932836 2531 True 4325.0 4325 97.4100 1 2548 1 chr3B.!!$R6 2547
2 TraesCS3B01G539700 chr3B 124558239 124560191 1952 True 2523.0 2523 89.9590 581 2548 1 chr3B.!!$R3 1967
3 TraesCS3B01G539700 chr3B 124500389 124502329 1940 True 2514.0 2514 90.0050 581 2537 1 chr3B.!!$R2 1956
4 TraesCS3B01G539700 chr3B 124397739 124399476 1737 True 2263.0 2263 90.1420 581 2331 1 chr3B.!!$R1 1750
5 TraesCS3B01G539700 chr3B 778703569 778705217 1648 True 407.5 449 92.1415 1 585 2 chr3B.!!$R8 584
6 TraesCS3B01G539700 chr2D 12542141 12544107 1966 True 2590.0 2590 90.4690 578 2548 1 chr2D.!!$R1 1970
7 TraesCS3B01G539700 chr2D 590927847 590929812 1965 True 2566.0 2566 90.2320 571 2546 1 chr2D.!!$R2 1975
8 TraesCS3B01G539700 chr6A 574944071 574946044 1973 True 2490.0 2490 89.5060 579 2548 1 chr6A.!!$R1 1969
9 TraesCS3B01G539700 chr2B 540525731 540527674 1943 False 2405.0 2405 88.9730 580 2548 1 chr2B.!!$F1 1968
10 TraesCS3B01G539700 chr5D 257136361 257138235 1874 False 2322.0 2322 89.0410 585 2471 1 chr5D.!!$F1 1886
11 TraesCS3B01G539700 chr5D 353833691 353835367 1676 True 2270.0 2270 91.0480 846 2538 1 chr5D.!!$R1 1692
12 TraesCS3B01G539700 chr3A 47284897 47286625 1728 False 2198.0 2198 89.5880 579 2321 1 chr3A.!!$F1 1742
13 TraesCS3B01G539700 chr6D 25857863 25859459 1596 False 2045.0 2045 89.7670 581 2200 1 chr6D.!!$F1 1619
14 TraesCS3B01G539700 chr4B 35634874 35636497 1623 False 1953.0 1953 88.4830 924 2548 1 chr4B.!!$F1 1624
15 TraesCS3B01G539700 chrUn 110637312 110638652 1340 False 1777.0 1777 90.7680 1216 2548 1 chrUn.!!$F1 1332

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
405 1462 2.053627 GTTTGCCGCATGTTTCTTCAG 58.946 47.619 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2313 3479 2.328319 ACCCTAAACCAAGTCACCGTA 58.672 47.619 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 4.785346 AGGCCTCATCAACATACTCAAT 57.215 40.909 0.00 0.00 0.00 2.57
165 166 2.119457 GCTTTTGTTTGCGAGGTCTTG 58.881 47.619 0.00 0.00 0.00 3.02
405 1462 2.053627 GTTTGCCGCATGTTTCTTCAG 58.946 47.619 0.00 0.00 0.00 3.02
892 2011 4.121669 GCGGCGACAGAGAGAGCA 62.122 66.667 12.98 0.00 0.00 4.26
1232 2353 2.143122 TGAGTTGATCTGTTTGGCGTC 58.857 47.619 0.00 0.00 0.00 5.19
1285 2406 0.543883 TGCTCTGGCCAAGACTCTCT 60.544 55.000 7.01 0.00 37.74 3.10
1290 2411 0.907486 TGGCCAAGACTCTCTGATGG 59.093 55.000 0.61 0.00 0.00 3.51
1528 2658 2.083774 CGCACTGGGTGTAATGTTGAT 58.916 47.619 0.00 0.00 35.75 2.57
1742 2894 2.039480 TCTGCTCTGCCTTTCTGTCAAT 59.961 45.455 0.00 0.00 0.00 2.57
1848 3002 1.271934 CATTCGGGGTGCACAAATGAA 59.728 47.619 20.43 16.04 30.64 2.57
2257 3422 1.855295 TAGGACTGCGGTGATAACCA 58.145 50.000 0.80 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 166 1.829222 TCCCCTACGAGTTCATCCAAC 59.171 52.381 0.00 0.00 34.86 3.77
367 1424 0.511221 ACAAACTTCGTTGCGGATCG 59.489 50.000 0.45 0.45 31.29 3.69
892 2011 2.357517 CCGTGCTCTTTGTCGCCT 60.358 61.111 0.00 0.00 0.00 5.52
1232 2353 3.947910 AGAAACATTTCACCTGCATGG 57.052 42.857 7.10 0.00 39.61 3.66
1285 2406 4.097437 GCTCTTCTTGCAATTCATCCATCA 59.903 41.667 0.00 0.00 0.00 3.07
1290 2411 5.244785 TCATGCTCTTCTTGCAATTCATC 57.755 39.130 0.00 0.00 44.01 2.92
1528 2658 8.685427 CCATAATTCATGTCTTTCCATACAACA 58.315 33.333 0.00 0.00 32.21 3.33
1765 2917 3.281727 TGGCTATCCGCTCTGAATTTT 57.718 42.857 0.00 0.00 39.13 1.82
1848 3002 4.900635 ACAGAAAAACACGCAAGAGATT 57.099 36.364 0.00 0.00 43.62 2.40
2096 3258 4.944619 TGTTCATTAATGTTGGCACCAA 57.055 36.364 14.97 0.00 0.00 3.67
2172 3336 5.978322 GCACCAATTTTTGTGCATTTTTCAT 59.022 32.000 15.88 0.00 37.51 2.57
2257 3422 5.548056 TCAAAGTCTTTCCATCTTCCCTAGT 59.452 40.000 0.00 0.00 0.00 2.57
2311 3477 3.328637 ACCCTAAACCAAGTCACCGTATT 59.671 43.478 0.00 0.00 0.00 1.89
2313 3479 2.328319 ACCCTAAACCAAGTCACCGTA 58.672 47.619 0.00 0.00 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.