Multiple sequence alignment - TraesCS3B01G529500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G529500 chr3B 100.000 2899 0 0 1 2899 771120420 771123318 0.000000e+00 5354
1 TraesCS3B01G529500 chr3B 98.343 1991 31 2 909 2899 445988974 445986986 0.000000e+00 3493
2 TraesCS3B01G529500 chr3B 97.991 1991 38 2 909 2899 761603831 761601843 0.000000e+00 3454
3 TraesCS3B01G529500 chr3B 97.831 922 20 0 1 922 761607275 761606354 0.000000e+00 1592
4 TraesCS3B01G529500 chr3B 97.722 922 21 0 1 922 445999600 445998679 0.000000e+00 1587
5 TraesCS3B01G529500 chr5B 98.242 1991 33 2 909 2899 528558091 528560079 0.000000e+00 3482
6 TraesCS3B01G529500 chrUn 98.603 1861 26 0 1039 2899 355962244 355960384 0.000000e+00 3293
7 TraesCS3B01G529500 chrUn 96.615 1034 32 3 909 1942 315537812 315536782 0.000000e+00 1712
8 TraesCS3B01G529500 chrUn 94.796 884 34 10 2017 2899 79243579 79244451 0.000000e+00 1367
9 TraesCS3B01G529500 chrUn 97.647 765 18 0 158 922 392645611 392646375 0.000000e+00 1314
10 TraesCS3B01G529500 chrUn 93.900 623 19 4 1 623 366254079 366254682 0.000000e+00 922
11 TraesCS3B01G529500 chrUn 97.407 270 7 0 627 896 366254771 366255040 7.320000e-126 460
12 TraesCS3B01G529500 chrUn 89.474 133 7 3 1931 2060 79243447 79243575 8.310000e-36 161
13 TraesCS3B01G529500 chrUn 89.474 133 7 3 1931 2060 315536698 315536570 8.310000e-36 161
14 TraesCS3B01G529500 chr2A 98.350 1273 21 0 1627 2899 730607078 730608350 0.000000e+00 2235
15 TraesCS3B01G529500 chr2A 98.048 922 18 0 1 922 730604835 730605756 0.000000e+00 1604
16 TraesCS3B01G529500 chr1B 97.590 1079 24 2 909 1987 587489788 587488712 0.000000e+00 1847
17 TraesCS3B01G529500 chr1B 98.048 922 18 0 1 922 587493242 587492321 0.000000e+00 1604
18 TraesCS3B01G529500 chr7A 96.809 1034 30 3 909 1942 18100135 18099105 0.000000e+00 1724
19 TraesCS3B01G529500 chr7A 93.900 623 19 4 1 623 18103635 18103032 0.000000e+00 922
20 TraesCS3B01G529500 chr7A 97.794 272 6 0 625 896 18102945 18102674 1.220000e-128 470
21 TraesCS3B01G529500 chr6B 96.976 1025 28 3 909 1933 674923119 674924140 0.000000e+00 1718
22 TraesCS3B01G529500 chr6B 94.910 884 33 10 2017 2899 674924365 674925237 0.000000e+00 1373
23 TraesCS3B01G529500 chr6B 93.900 623 19 4 1 623 674919731 674920334 0.000000e+00 922
24 TraesCS3B01G529500 chr6B 97.407 270 7 0 627 896 674920423 674920692 7.320000e-126 460
25 TraesCS3B01G529500 chr6A 94.872 1014 49 2 922 1933 23195825 23194813 0.000000e+00 1581
26 TraesCS3B01G529500 chr6A 94.770 956 37 6 1951 2899 23194683 23193734 0.000000e+00 1476
27 TraesCS3B01G529500 chr6A 90.836 622 31 4 1 615 23199331 23198729 0.000000e+00 809
28 TraesCS3B01G529500 chr3D 96.263 883 26 6 2017 2899 556048138 556047263 0.000000e+00 1441
29 TraesCS3B01G529500 chr3D 95.333 450 13 1 1 450 556057910 556057469 0.000000e+00 708
30 TraesCS3B01G529500 chr3D 97.315 298 8 0 625 922 556049304 556049007 9.270000e-140 507
31 TraesCS3B01G529500 chr3D 90.977 133 6 2 1931 2060 556048271 556048142 1.070000e-39 174


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G529500 chr3B 771120420 771123318 2898 False 5354.000000 5354 100.000000 1 2899 1 chr3B.!!$F1 2898
1 TraesCS3B01G529500 chr3B 445986986 445988974 1988 True 3493.000000 3493 98.343000 909 2899 1 chr3B.!!$R1 1990
2 TraesCS3B01G529500 chr3B 761601843 761607275 5432 True 2523.000000 3454 97.911000 1 2899 2 chr3B.!!$R3 2898
3 TraesCS3B01G529500 chr3B 445998679 445999600 921 True 1587.000000 1587 97.722000 1 922 1 chr3B.!!$R2 921
4 TraesCS3B01G529500 chr5B 528558091 528560079 1988 False 3482.000000 3482 98.242000 909 2899 1 chr5B.!!$F1 1990
5 TraesCS3B01G529500 chrUn 355960384 355962244 1860 True 3293.000000 3293 98.603000 1039 2899 1 chrUn.!!$R1 1860
6 TraesCS3B01G529500 chrUn 392645611 392646375 764 False 1314.000000 1314 97.647000 158 922 1 chrUn.!!$F1 764
7 TraesCS3B01G529500 chrUn 315536570 315537812 1242 True 936.500000 1712 93.044500 909 2060 2 chrUn.!!$R2 1151
8 TraesCS3B01G529500 chrUn 79243447 79244451 1004 False 764.000000 1367 92.135000 1931 2899 2 chrUn.!!$F2 968
9 TraesCS3B01G529500 chrUn 366254079 366255040 961 False 691.000000 922 95.653500 1 896 2 chrUn.!!$F3 895
10 TraesCS3B01G529500 chr2A 730604835 730608350 3515 False 1919.500000 2235 98.199000 1 2899 2 chr2A.!!$F1 2898
11 TraesCS3B01G529500 chr1B 587488712 587493242 4530 True 1725.500000 1847 97.819000 1 1987 2 chr1B.!!$R1 1986
12 TraesCS3B01G529500 chr7A 18099105 18103635 4530 True 1038.666667 1724 96.167667 1 1942 3 chr7A.!!$R1 1941
13 TraesCS3B01G529500 chr6B 674919731 674925237 5506 False 1118.250000 1718 95.798250 1 2899 4 chr6B.!!$F1 2898
14 TraesCS3B01G529500 chr6A 23193734 23199331 5597 True 1288.666667 1581 93.492667 1 2899 3 chr6A.!!$R1 2898
15 TraesCS3B01G529500 chr3D 556047263 556049304 2041 True 707.333333 1441 94.851667 625 2899 3 chr3D.!!$R2 2274

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
615 623 1.855213 GCTTGTTGCTGCATCGGACA 61.855 55.000 1.84 1.33 38.95 4.02 F
1125 3801 3.824001 TCAATTTGGAGGGGATGTTCA 57.176 42.857 0.00 0.00 0.00 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1754 4432 3.067180 CCACTTGCATTTGTGTCTCTTGT 59.933 43.478 12.03 0.0 32.76 3.16 R
2785 5759 4.979943 TCAAAGCATGACACTGAAACAA 57.020 36.364 0.00 0.0 31.50 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 148 2.363018 CTCTGGCTCCTCCCGTGA 60.363 66.667 0.00 0.00 0.00 4.35
310 318 4.015084 CCTGTCCATTGCTTCTTCAAGAT 58.985 43.478 0.00 0.00 0.00 2.40
357 365 2.046988 CAGAGGTGATGGTGCGCA 60.047 61.111 5.66 5.66 0.00 6.09
615 623 1.855213 GCTTGTTGCTGCATCGGACA 61.855 55.000 1.84 1.33 38.95 4.02
1125 3801 3.824001 TCAATTTGGAGGGGATGTTCA 57.176 42.857 0.00 0.00 0.00 3.18
1465 4143 5.359292 TGGACACAACAATGTTTGATGAAGA 59.641 36.000 12.68 0.00 37.82 2.87
1568 4246 3.927142 AGAAAATAAGGCGTCTCAACTCG 59.073 43.478 0.00 0.00 0.00 4.18
1904 4582 4.270834 ACAGCCTCTACTCGTAGATTTGA 58.729 43.478 7.20 0.00 40.97 2.69
1970 4855 5.885912 TCACTGTGTATGATCAGTACTGCTA 59.114 40.000 18.45 6.97 42.05 3.49
2038 4929 7.880160 AATTGCCACTTATCTTGTATTGCTA 57.120 32.000 0.00 0.00 0.00 3.49
2153 5126 4.843220 ATGCACAAAGTGGAAGAAGAAG 57.157 40.909 0.00 0.00 37.44 2.85
2268 5241 2.239402 TGGATGTATGCAAGCTTGGAGA 59.761 45.455 27.10 19.88 30.13 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
341 349 1.376424 CTTGCGCACCATCACCTCT 60.376 57.895 11.12 0.0 0.00 3.69
357 365 0.106918 TCCGTTGAACTGGTTGGCTT 60.107 50.000 6.20 0.0 0.00 4.35
615 623 2.431601 GACTCGTCGCAGCAAGCT 60.432 61.111 0.00 0.0 42.61 3.74
995 3671 3.582647 TGTCTTACTTGGCTCCATTCTCA 59.417 43.478 0.00 0.0 0.00 3.27
1125 3801 0.963225 TGCACACTTCTGCAATGCAT 59.037 45.000 8.91 0.0 44.28 3.96
1380 4056 4.879197 TCTCTTGATCTTCTTCAGCACA 57.121 40.909 0.00 0.0 0.00 4.57
1568 4246 3.584733 ACATAAGAATCCTTCCTGCCC 57.415 47.619 0.00 0.0 33.94 5.36
1754 4432 3.067180 CCACTTGCATTTGTGTCTCTTGT 59.933 43.478 12.03 0.0 32.76 3.16
1904 4582 7.535997 GGAAACGCCAAAAATAAGAGACTTAT 58.464 34.615 0.00 0.0 36.34 1.73
1970 4855 9.890629 TGATAATTGACAAGTAGCAATTAGAGT 57.109 29.630 10.85 0.0 45.03 3.24
2785 5759 4.979943 TCAAAGCATGACACTGAAACAA 57.020 36.364 0.00 0.0 31.50 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.