Multiple sequence alignment - TraesCS3B01G527100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G527100 chr3B 100.000 2882 0 0 1 2882 769268897 769266016 0.000000e+00 5323.0
1 TraesCS3B01G527100 chr3B 92.582 2912 166 14 1 2873 769379378 769376478 0.000000e+00 4135.0
2 TraesCS3B01G527100 chr3B 95.005 2222 84 6 588 2786 770404631 770402414 0.000000e+00 3463.0
3 TraesCS3B01G527100 chr3B 91.953 2150 131 12 666 2785 769489084 769486947 0.000000e+00 2974.0
4 TraesCS3B01G527100 chr3B 97.124 1669 48 0 1 1669 770315389 770313721 0.000000e+00 2817.0
5 TraesCS3B01G527100 chr3B 90.389 2133 150 16 1 2088 770098570 770096448 0.000000e+00 2752.0
6 TraesCS3B01G527100 chr3B 89.118 1792 168 4 875 2639 770313218 770311427 0.000000e+00 2204.0
7 TraesCS3B01G527100 chr3B 88.101 1664 185 6 980 2639 770208692 770207038 0.000000e+00 1964.0
8 TraesCS3B01G527100 chr3B 88.041 1664 185 7 980 2639 769906921 769905268 0.000000e+00 1958.0
9 TraesCS3B01G527100 chr3B 88.863 1275 110 15 589 1833 769995550 769994278 0.000000e+00 1539.0
10 TraesCS3B01G527100 chr3B 80.771 1945 337 30 630 2558 770229381 770227458 0.000000e+00 1485.0
11 TraesCS3B01G527100 chr3B 94.553 716 39 0 1421 2136 769456621 769455906 0.000000e+00 1107.0
12 TraesCS3B01G527100 chr3B 98.824 595 6 1 1 594 770007921 770007327 0.000000e+00 1059.0
13 TraesCS3B01G527100 chr3B 93.323 644 42 1 2088 2730 770089063 770088420 0.000000e+00 950.0
14 TraesCS3B01G527100 chr3B 91.852 675 41 5 1 670 769511021 769510356 0.000000e+00 929.0
15 TraesCS3B01G527100 chr3B 93.291 626 38 3 1 626 769459466 769458845 0.000000e+00 920.0
16 TraesCS3B01G527100 chr3B 77.210 1606 334 23 996 2583 770109077 770107486 0.000000e+00 909.0
17 TraesCS3B01G527100 chr3B 91.074 605 45 3 2190 2785 769454681 769454077 0.000000e+00 809.0
18 TraesCS3B01G527100 chr3B 87.731 432 33 5 684 1099 769330630 769330203 1.200000e-133 486.0
19 TraesCS3B01G527100 chr3B 90.778 347 27 5 2305 2648 770355764 770355420 2.620000e-125 459.0
20 TraesCS3B01G527100 chr3B 90.674 193 13 3 1 193 770407017 770406830 4.770000e-63 252.0
21 TraesCS3B01G527100 chr3B 90.698 129 11 1 2750 2878 770086613 770086486 1.370000e-38 171.0
22 TraesCS3B01G527100 chr3A 82.768 2269 335 34 368 2602 712655763 712653517 0.000000e+00 1973.0
23 TraesCS3B01G527100 chr2D 84.615 234 30 2 2641 2868 483080659 483080892 8.030000e-56 228.0
24 TraesCS3B01G527100 chr2D 83.399 253 32 6 2633 2878 483124387 483124636 2.890000e-55 226.0
25 TraesCS3B01G527100 chr2D 82.008 239 30 5 2641 2878 483077610 483077836 1.050000e-44 191.0
26 TraesCS3B01G527100 chr2D 80.000 225 39 2 2641 2859 483124391 483124167 8.260000e-36 161.0
27 TraesCS3B01G527100 chr5B 90.533 169 11 4 193 361 48622629 48622466 4.830000e-53 219.0
28 TraesCS3B01G527100 chr5B 89.595 173 14 2 192 364 409866842 409867010 1.740000e-52 217.0
29 TraesCS3B01G527100 chr5B 81.771 192 31 3 9 196 233998167 233997976 1.070000e-34 158.0
30 TraesCS3B01G527100 chr5B 100.000 29 0 0 2783 2811 600289405 600289377 1.000000e-03 54.7
31 TraesCS3B01G527100 chrUn 89.143 175 13 4 195 367 141680907 141680737 2.250000e-51 213.0
32 TraesCS3B01G527100 chr2A 92.308 39 3 0 2783 2821 670240200 670240162 4.010000e-04 56.5
33 TraesCS3B01G527100 chr2A 96.970 33 1 0 2783 2815 683551856 683551888 4.010000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G527100 chr3B 769266016 769268897 2881 True 5323.000000 5323 100.000000 1 2882 1 chr3B.!!$R1 2881
1 TraesCS3B01G527100 chr3B 769376478 769379378 2900 True 4135.000000 4135 92.582000 1 2873 1 chr3B.!!$R3 2872
2 TraesCS3B01G527100 chr3B 769486947 769489084 2137 True 2974.000000 2974 91.953000 666 2785 1 chr3B.!!$R4 2119
3 TraesCS3B01G527100 chr3B 770096448 770098570 2122 True 2752.000000 2752 90.389000 1 2088 1 chr3B.!!$R9 2087
4 TraesCS3B01G527100 chr3B 770311427 770315389 3962 True 2510.500000 2817 93.121000 1 2639 2 chr3B.!!$R16 2638
5 TraesCS3B01G527100 chr3B 770207038 770208692 1654 True 1964.000000 1964 88.101000 980 2639 1 chr3B.!!$R11 1659
6 TraesCS3B01G527100 chr3B 769905268 769906921 1653 True 1958.000000 1958 88.041000 980 2639 1 chr3B.!!$R6 1659
7 TraesCS3B01G527100 chr3B 770402414 770407017 4603 True 1857.500000 3463 92.839500 1 2786 2 chr3B.!!$R17 2785
8 TraesCS3B01G527100 chr3B 769994278 769995550 1272 True 1539.000000 1539 88.863000 589 1833 1 chr3B.!!$R7 1244
9 TraesCS3B01G527100 chr3B 770227458 770229381 1923 True 1485.000000 1485 80.771000 630 2558 1 chr3B.!!$R12 1928
10 TraesCS3B01G527100 chr3B 770007327 770007921 594 True 1059.000000 1059 98.824000 1 594 1 chr3B.!!$R8 593
11 TraesCS3B01G527100 chr3B 769454077 769459466 5389 True 945.333333 1107 92.972667 1 2785 3 chr3B.!!$R14 2784
12 TraesCS3B01G527100 chr3B 769510356 769511021 665 True 929.000000 929 91.852000 1 670 1 chr3B.!!$R5 669
13 TraesCS3B01G527100 chr3B 770107486 770109077 1591 True 909.000000 909 77.210000 996 2583 1 chr3B.!!$R10 1587
14 TraesCS3B01G527100 chr3B 770086486 770089063 2577 True 560.500000 950 92.010500 2088 2878 2 chr3B.!!$R15 790
15 TraesCS3B01G527100 chr3A 712653517 712655763 2246 True 1973.000000 1973 82.768000 368 2602 1 chr3A.!!$R1 2234
16 TraesCS3B01G527100 chr2D 483077610 483080892 3282 False 209.500000 228 83.311500 2641 2878 2 chr2D.!!$F2 237

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
179 200 1.676746 GCAGGCACATCATCATCACT 58.323 50.0 0.00 0.00 0.00 3.41 F
1483 6164 0.179076 CAGGTATGTGCAGATCGGCA 60.179 55.0 16.96 16.96 42.53 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1835 6519 1.86534 GAACCCAGTGTTTCTCGTGTC 59.135 52.381 0.0 0.0 37.29 3.67 R
2382 8272 0.39034 CTCTGCGTGCTCCAAGCTTA 60.390 55.000 0.0 0.0 42.97 3.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
179 200 1.676746 GCAGGCACATCATCATCACT 58.323 50.000 0.00 0.00 0.00 3.41
993 4407 3.938963 AGGGTATTGCTACACACAAATCG 59.061 43.478 0.00 0.00 33.38 3.34
1483 6164 0.179076 CAGGTATGTGCAGATCGGCA 60.179 55.000 16.96 16.96 42.53 5.69
1618 6302 2.460669 GGCCAATCAATTTCCAGGAGT 58.539 47.619 0.00 0.00 0.00 3.85
1835 6519 2.095567 CGCAAGATTTCTCCTGTGTTGG 60.096 50.000 0.00 0.00 43.02 3.77
1880 6564 6.811665 CACGTCCATAGAACTTTGACTGAATA 59.188 38.462 0.00 0.00 0.00 1.75
2066 6761 2.808933 CGGAGTACAAAAACCTGCCAGA 60.809 50.000 0.00 0.00 0.00 3.86
2220 8110 3.290308 GATACAGAGAATCGACGCCAT 57.710 47.619 0.00 0.00 42.67 4.40
2382 8272 2.484889 GAGAAGACAAGTGCGGAAAGT 58.515 47.619 0.00 0.00 0.00 2.66
2418 8308 0.601558 GAGCCACACGACAAGGTAGA 59.398 55.000 0.00 0.00 0.00 2.59
2426 8316 5.120208 CCACACGACAAGGTAGAAACATTAG 59.880 44.000 0.00 0.00 0.00 1.73
2517 8413 7.334921 CGTTCATTCCTAAAACTATGGGTTGTA 59.665 37.037 0.00 0.00 38.29 2.41
2746 12716 1.520120 CGTGGCAGCAGATGACGAT 60.520 57.895 0.00 0.00 41.39 3.73
2772 12742 2.753043 CCTGCTGCCATGTGGTCC 60.753 66.667 0.00 0.00 37.57 4.46
2868 13607 2.807622 GGAATGGATTGGCACCGC 59.192 61.111 0.00 0.00 0.00 5.68
2880 13619 4.155733 CACCGCGGCATCCTGGTA 62.156 66.667 28.58 0.00 30.57 3.25
2881 13620 3.849951 ACCGCGGCATCCTGGTAG 61.850 66.667 28.58 0.00 30.06 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
179 200 5.337813 GGAGGGAGTACAAAAGATTCGGTTA 60.338 44.000 0.00 0.0 0.00 2.85
993 4407 0.959553 CCATCTCAGCCATGGATTGC 59.040 55.000 18.40 0.0 43.32 3.56
1835 6519 1.865340 GAACCCAGTGTTTCTCGTGTC 59.135 52.381 0.00 0.0 37.29 3.67
1880 6564 3.711704 ACATAATGGATCTGGACGGAACT 59.288 43.478 0.00 0.0 0.00 3.01
2066 6761 3.417101 TGACCAGCAAATACGGTTGATT 58.583 40.909 0.50 0.0 31.63 2.57
2220 8110 6.372381 CCAGATGAACATTTACATGTGTGAGA 59.628 38.462 9.11 0.0 43.34 3.27
2382 8272 0.390340 CTCTGCGTGCTCCAAGCTTA 60.390 55.000 0.00 0.0 42.97 3.09
2418 8308 2.557452 CCCCTTGGCACTCCTAATGTTT 60.557 50.000 0.00 0.0 0.00 2.83
2426 8316 1.606601 GGAAACCCCTTGGCACTCC 60.607 63.158 0.00 0.0 33.59 3.85
2615 8515 8.651389 CCTTAGGAATACATTTGATCCTCTACA 58.349 37.037 0.00 0.0 41.33 2.74
2627 8530 8.801882 TTGACGAAAATCCTTAGGAATACATT 57.198 30.769 4.56 0.0 34.34 2.71
2639 8542 2.299013 GGCCCTTTTTGACGAAAATCCT 59.701 45.455 1.00 0.0 36.68 3.24
2696 10879 8.141268 GGTGGTCATTTTTGACATTTTTCTCTA 58.859 33.333 8.25 0.0 40.38 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.