Multiple sequence alignment - TraesCS3B01G526900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G526900 chr3B 100.000 3584 0 0 1 3584 769155643 769159226 0.000000e+00 6619.0
1 TraesCS3B01G526900 chr3B 98.776 3596 29 3 1 3584 769193383 769189791 0.000000e+00 6383.0
2 TraesCS3B01G526900 chr3B 87.554 2073 214 16 637 2675 769704211 769702149 0.000000e+00 2359.0
3 TraesCS3B01G526900 chr3B 92.056 1133 84 6 1704 2835 769309613 769308486 0.000000e+00 1589.0
4 TraesCS3B01G526900 chr3B 91.637 1124 89 5 1709 2831 770357906 770356787 0.000000e+00 1550.0
5 TraesCS3B01G526900 chr3B 78.991 1685 327 22 964 2631 770404243 770402569 0.000000e+00 1125.0
6 TraesCS3B01G526900 chr3B 78.525 1681 341 17 964 2631 769488775 769487102 0.000000e+00 1086.0
7 TraesCS3B01G526900 chr3B 78.834 1630 323 17 1001 2616 769267897 769266276 0.000000e+00 1079.0
8 TraesCS3B01G526900 chr3B 78.256 1697 347 22 968 2653 770208706 770207021 0.000000e+00 1070.0
9 TraesCS3B01G526900 chr3B 78.164 1699 344 26 968 2653 769906935 769905251 0.000000e+00 1057.0
10 TraesCS3B01G526900 chr3B 79.801 604 93 10 2833 3417 769308284 769307691 2.570000e-111 412.0
11 TraesCS3B01G526900 chr3B 79.636 604 92 12 2833 3417 770356581 770355990 4.310000e-109 405.0
12 TraesCS3B01G526900 chr3B 83.026 271 43 2 3000 3267 132082687 132082957 3.570000e-60 243.0
13 TraesCS3B01G526900 chr3B 81.522 184 20 5 3415 3584 302130104 302129921 4.820000e-29 139.0
14 TraesCS3B01G526900 chr3B 100.000 42 0 0 316 357 769787377 769787336 1.070000e-10 78.7
15 TraesCS3B01G526900 chrUn 99.102 2338 21 0 528 2865 344085119 344087456 0.000000e+00 4202.0
16 TraesCS3B01G526900 chrUn 98.607 1364 16 1 2221 3584 333458557 333457197 0.000000e+00 2410.0
17 TraesCS3B01G526900 chrUn 99.046 1048 6 3 1 1047 319854334 319853290 0.000000e+00 1877.0
18 TraesCS3B01G526900 chrUn 98.856 1049 7 4 1 1047 319834008 319832963 0.000000e+00 1866.0
19 TraesCS3B01G526900 chrUn 82.971 276 40 6 3000 3270 64730504 64730231 3.570000e-60 243.0
20 TraesCS3B01G526900 chr3A 91.104 3024 196 43 423 3418 712576369 712573391 0.000000e+00 4026.0
21 TraesCS3B01G526900 chr3A 80.559 1610 271 26 964 2550 712655152 712653562 0.000000e+00 1201.0
22 TraesCS3B01G526900 chr3A 81.342 477 54 13 2924 3398 44579413 44579856 4.400000e-94 355.0
23 TraesCS3B01G526900 chr3A 88.608 79 8 1 3506 3584 663673485 663673562 1.060000e-15 95.3
24 TraesCS3B01G526900 chr3D 94.396 2177 104 7 423 2594 577284861 577282698 0.000000e+00 3328.0
25 TraesCS3B01G526900 chr3D 83.150 819 106 17 2621 3417 577282700 577281892 0.000000e+00 719.0
26 TraesCS3B01G526900 chr3D 73.780 1598 323 57 1000 2553 577341240 577339695 3.150000e-150 542.0
27 TraesCS3B01G526900 chr3D 93.987 316 12 6 1 314 39042578 39042268 4.190000e-129 472.0
28 TraesCS3B01G526900 chr7D 94.888 313 14 2 1 313 430098790 430099100 4.160000e-134 488.0
29 TraesCS3B01G526900 chr7D 87.027 185 23 1 2676 2860 449504546 449504363 1.300000e-49 207.0
30 TraesCS3B01G526900 chr7D 86.139 101 14 0 3313 3413 574100481 574100381 3.780000e-20 110.0
31 TraesCS3B01G526900 chr5B 94.249 313 18 0 1 313 485447021 485446709 2.500000e-131 479.0
32 TraesCS3B01G526900 chr5B 93.930 313 13 2 1 313 668102858 668103164 5.420000e-128 468.0
33 TraesCS3B01G526900 chr5B 82.784 273 45 1 3000 3270 691748963 691748691 3.570000e-60 243.0
34 TraesCS3B01G526900 chr4D 94.249 313 17 1 1 313 462814466 462814777 9.000000e-131 477.0
35 TraesCS3B01G526900 chr4D 82.667 150 19 3 2934 3076 85853427 85853278 3.760000e-25 126.0
36 TraesCS3B01G526900 chr1D 94.249 313 16 2 1 313 77647156 77647466 9.000000e-131 477.0
37 TraesCS3B01G526900 chr1D 81.421 183 19 4 3416 3584 198757202 198757383 6.240000e-28 135.0
38 TraesCS3B01G526900 chr5D 79.891 368 52 10 2966 3332 27280245 27280591 2.140000e-62 250.0
39 TraesCS3B01G526900 chr5D 79.050 358 59 9 2976 3332 431972780 431973122 7.740000e-57 231.0
40 TraesCS3B01G526900 chr5D 88.235 102 11 1 3313 3413 510552925 510553026 1.750000e-23 121.0
41 TraesCS3B01G526900 chr1B 83.209 268 43 1 3000 3265 593788797 593788530 9.940000e-61 244.0
42 TraesCS3B01G526900 chr1B 83.851 161 16 4 2670 2830 680981108 680981258 1.040000e-30 145.0
43 TraesCS3B01G526900 chr6D 83.673 147 17 3 2934 3073 440672745 440672891 8.070000e-27 132.0
44 TraesCS3B01G526900 chr7A 82.313 147 19 3 2934 3073 658271499 658271645 1.750000e-23 121.0
45 TraesCS3B01G526900 chr2D 82.000 150 20 3 2934 3076 29097374 29097225 1.750000e-23 121.0
46 TraesCS3B01G526900 chr2A 80.272 147 22 3 2934 3073 764882348 764882494 1.760000e-18 104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G526900 chr3B 769155643 769159226 3583 False 6619.0 6619 100.0000 1 3584 1 chr3B.!!$F2 3583
1 TraesCS3B01G526900 chr3B 769189791 769193383 3592 True 6383.0 6383 98.7760 1 3584 1 chr3B.!!$R2 3583
2 TraesCS3B01G526900 chr3B 769702149 769704211 2062 True 2359.0 2359 87.5540 637 2675 1 chr3B.!!$R5 2038
3 TraesCS3B01G526900 chr3B 770402569 770404243 1674 True 1125.0 1125 78.9910 964 2631 1 chr3B.!!$R9 1667
4 TraesCS3B01G526900 chr3B 769487102 769488775 1673 True 1086.0 1086 78.5250 964 2631 1 chr3B.!!$R4 1667
5 TraesCS3B01G526900 chr3B 769266276 769267897 1621 True 1079.0 1079 78.8340 1001 2616 1 chr3B.!!$R3 1615
6 TraesCS3B01G526900 chr3B 770207021 770208706 1685 True 1070.0 1070 78.2560 968 2653 1 chr3B.!!$R8 1685
7 TraesCS3B01G526900 chr3B 769905251 769906935 1684 True 1057.0 1057 78.1640 968 2653 1 chr3B.!!$R7 1685
8 TraesCS3B01G526900 chr3B 769307691 769309613 1922 True 1000.5 1589 85.9285 1704 3417 2 chr3B.!!$R10 1713
9 TraesCS3B01G526900 chr3B 770355990 770357906 1916 True 977.5 1550 85.6365 1709 3417 2 chr3B.!!$R11 1708
10 TraesCS3B01G526900 chrUn 344085119 344087456 2337 False 4202.0 4202 99.1020 528 2865 1 chrUn.!!$F1 2337
11 TraesCS3B01G526900 chrUn 333457197 333458557 1360 True 2410.0 2410 98.6070 2221 3584 1 chrUn.!!$R4 1363
12 TraesCS3B01G526900 chrUn 319853290 319854334 1044 True 1877.0 1877 99.0460 1 1047 1 chrUn.!!$R3 1046
13 TraesCS3B01G526900 chrUn 319832963 319834008 1045 True 1866.0 1866 98.8560 1 1047 1 chrUn.!!$R2 1046
14 TraesCS3B01G526900 chr3A 712573391 712576369 2978 True 4026.0 4026 91.1040 423 3418 1 chr3A.!!$R1 2995
15 TraesCS3B01G526900 chr3A 712653562 712655152 1590 True 1201.0 1201 80.5590 964 2550 1 chr3A.!!$R2 1586
16 TraesCS3B01G526900 chr3D 577281892 577284861 2969 True 2023.5 3328 88.7730 423 3417 2 chr3D.!!$R3 2994
17 TraesCS3B01G526900 chr3D 577339695 577341240 1545 True 542.0 542 73.7800 1000 2553 1 chr3D.!!$R2 1553

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
795 799 3.442273 TCCGCCAATTGTCTTTATCAACC 59.558 43.478 4.43 0.0 0.00 3.77 F
1511 1543 0.734889 CGGCAGCACCTATTCTTTGG 59.265 55.000 0.00 0.0 35.61 3.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1839 1889 0.757561 TGTCGGTCAAGTGTCCCTCA 60.758 55.000 0.0 0.0 0.00 3.86 R
2986 3298 3.170672 TCTGCAGGTGCCACCACT 61.171 61.111 17.8 0.0 41.95 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
378 379 4.759693 TCGGCATAAAACACAGTCTTTCAT 59.240 37.500 0.00 0.00 0.00 2.57
379 380 5.240623 TCGGCATAAAACACAGTCTTTCATT 59.759 36.000 0.00 0.00 0.00 2.57
795 799 3.442273 TCCGCCAATTGTCTTTATCAACC 59.558 43.478 4.43 0.00 0.00 3.77
1511 1543 0.734889 CGGCAGCACCTATTCTTTGG 59.265 55.000 0.00 0.00 35.61 3.28
1706 1738 1.130373 CGTGGTCATGCTGCGTATTTT 59.870 47.619 0.00 0.00 0.00 1.82
1839 1889 3.476552 AGATTTGTCGTGTGTTCCACAT 58.523 40.909 0.00 0.00 46.32 3.21
2050 2118 7.173562 GTCATATCTCAGTATCGGAGTACAGTT 59.826 40.741 0.00 0.00 34.04 3.16
2637 2726 5.092781 AGAACGTCACATGTGTTTCAAAAC 58.907 37.500 24.63 12.81 39.33 2.43
2986 3298 2.662596 GAGCCACCGATGACCACA 59.337 61.111 0.00 0.00 0.00 4.17
2988 3300 2.172483 GAGCCACCGATGACCACAGT 62.172 60.000 0.00 0.00 0.00 3.55
3300 3619 2.202919 CGTGCAGCATCCGATGGA 60.203 61.111 10.41 0.00 35.55 3.41
3369 3688 2.202690 CATACAGCGCCGGTTCGA 60.203 61.111 2.29 0.00 0.00 3.71
3436 3767 1.600916 GAGGCCTCGTTTGGTTGCT 60.601 57.895 19.06 0.00 0.00 3.91
3555 3886 2.066999 GGCCTTCCACGGGAGAGAT 61.067 63.158 0.00 0.00 31.21 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
795 799 7.183580 AGAGAGAAGAATTTTGTTTCACTCG 57.816 36.000 11.08 0.00 40.85 4.18
1494 1526 0.457443 GGCCAAAGAATAGGTGCTGC 59.543 55.000 0.00 0.00 0.00 5.25
1706 1738 3.889538 CCCGATTATGTCTGTACTCTCCA 59.110 47.826 0.00 0.00 0.00 3.86
1839 1889 0.757561 TGTCGGTCAAGTGTCCCTCA 60.758 55.000 0.00 0.00 0.00 3.86
2050 2118 1.656587 ACAGTTGATCCTGGCAGGTA 58.343 50.000 31.60 19.20 36.53 3.08
2637 2726 8.374728 CACATATTTTGGTTGTCAAATTGATCG 58.625 33.333 0.00 0.00 43.95 3.69
2986 3298 3.170672 TCTGCAGGTGCCACCACT 61.171 61.111 17.80 0.00 41.95 4.00
2988 3300 3.957586 CCTCTGCAGGTGCCACCA 61.958 66.667 17.80 0.00 41.95 4.17
3555 3886 5.068067 TCCTCGACGTATTGATATGTGGAAA 59.932 40.000 8.68 0.49 36.84 3.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.