Multiple sequence alignment - TraesCS3B01G524000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G524000 chr3B 100.000 2573 0 0 1 2573 766340998 766343570 0.000000e+00 4752
1 TraesCS3B01G524000 chr3B 84.151 265 42 0 2309 2573 473237220 473237484 9.130000e-65 257
2 TraesCS3B01G524000 chr3B 97.674 43 1 0 120 162 512390191 512390233 9.870000e-10 75
3 TraesCS3B01G524000 chr7B 98.964 2510 24 2 65 2573 73167096 73169604 0.000000e+00 4490
4 TraesCS3B01G524000 chr7B 95.686 2411 85 5 163 2573 517901753 517904144 0.000000e+00 3858
5 TraesCS3B01G524000 chr7B 95.000 120 5 1 1 120 517901630 517901748 1.220000e-43 187
6 TraesCS3B01G524000 chr2B 94.655 2582 126 7 1 2573 528810443 528807865 0.000000e+00 3993
7 TraesCS3B01G524000 chr2B 96.108 2415 88 5 163 2573 419937780 419940192 0.000000e+00 3934
8 TraesCS3B01G524000 chr7D 97.545 1996 45 3 163 2155 83758190 83760184 0.000000e+00 3411
9 TraesCS3B01G524000 chr7D 95.833 120 4 1 1 120 126714618 126714736 2.610000e-45 193
10 TraesCS3B01G524000 chr7D 95.000 120 5 1 1 120 83758067 83758185 1.220000e-43 187
11 TraesCS3B01G524000 chr7D 95.000 120 5 1 1 120 366438151 366438033 1.220000e-43 187
12 TraesCS3B01G524000 chr6B 95.521 1786 63 11 163 1944 676682893 676684665 0.000000e+00 2839
13 TraesCS3B01G524000 chr6B 95.723 1543 63 2 1033 2573 617031452 617032993 0.000000e+00 2481
14 TraesCS3B01G524000 chr6B 93.868 636 39 0 1938 2573 676703236 676703871 0.000000e+00 959
15 TraesCS3B01G524000 chr6B 90.779 629 29 14 120 724 138657751 138658374 0.000000e+00 813
16 TraesCS3B01G524000 chr6B 97.500 120 3 0 1 120 676682769 676682888 3.360000e-49 206
17 TraesCS3B01G524000 chr6B 96.639 119 4 0 2 120 617030860 617030978 5.620000e-47 198
18 TraesCS3B01G524000 chr1B 93.983 1529 74 4 1047 2573 344040425 344041937 0.000000e+00 2298
19 TraesCS3B01G524000 chr1B 96.584 1054 31 4 1 1051 344012630 344013681 0.000000e+00 1742
20 TraesCS3B01G524000 chr4B 95.303 1384 61 3 557 1937 43574175 43572793 0.000000e+00 2193
21 TraesCS3B01G524000 chr4B 95.087 1384 64 3 557 1937 43588041 43586659 0.000000e+00 2176
22 TraesCS3B01G524000 chr4B 95.171 642 30 1 1932 2573 43564379 43563739 0.000000e+00 1013
23 TraesCS3B01G524000 chr4B 95.344 494 21 2 1931 2424 43578259 43577768 0.000000e+00 784
24 TraesCS3B01G524000 chr6A 85.569 1871 222 29 268 2133 182420828 182419001 0.000000e+00 1916
25 TraesCS3B01G524000 chr2D 95.000 120 5 1 1 120 238092383 238092265 1.220000e-43 187


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G524000 chr3B 766340998 766343570 2572 False 4752.0 4752 100.0000 1 2573 1 chr3B.!!$F3 2572
1 TraesCS3B01G524000 chr7B 73167096 73169604 2508 False 4490.0 4490 98.9640 65 2573 1 chr7B.!!$F1 2508
2 TraesCS3B01G524000 chr7B 517901630 517904144 2514 False 2022.5 3858 95.3430 1 2573 2 chr7B.!!$F2 2572
3 TraesCS3B01G524000 chr2B 528807865 528810443 2578 True 3993.0 3993 94.6550 1 2573 1 chr2B.!!$R1 2572
4 TraesCS3B01G524000 chr2B 419937780 419940192 2412 False 3934.0 3934 96.1080 163 2573 1 chr2B.!!$F1 2410
5 TraesCS3B01G524000 chr7D 83758067 83760184 2117 False 1799.0 3411 96.2725 1 2155 2 chr7D.!!$F2 2154
6 TraesCS3B01G524000 chr6B 676682769 676684665 1896 False 1522.5 2839 96.5105 1 1944 2 chr6B.!!$F4 1943
7 TraesCS3B01G524000 chr6B 617030860 617032993 2133 False 1339.5 2481 96.1810 2 2573 2 chr6B.!!$F3 2571
8 TraesCS3B01G524000 chr6B 676703236 676703871 635 False 959.0 959 93.8680 1938 2573 1 chr6B.!!$F2 635
9 TraesCS3B01G524000 chr6B 138657751 138658374 623 False 813.0 813 90.7790 120 724 1 chr6B.!!$F1 604
10 TraesCS3B01G524000 chr1B 344040425 344041937 1512 False 2298.0 2298 93.9830 1047 2573 1 chr1B.!!$F2 1526
11 TraesCS3B01G524000 chr1B 344012630 344013681 1051 False 1742.0 1742 96.5840 1 1051 1 chr1B.!!$F1 1050
12 TraesCS3B01G524000 chr4B 43586659 43588041 1382 True 2176.0 2176 95.0870 557 1937 1 chr4B.!!$R2 1380
13 TraesCS3B01G524000 chr4B 43572793 43578259 5466 True 1488.5 2193 95.3235 557 2424 2 chr4B.!!$R3 1867
14 TraesCS3B01G524000 chr4B 43563739 43564379 640 True 1013.0 1013 95.1710 1932 2573 1 chr4B.!!$R1 641
15 TraesCS3B01G524000 chr6A 182419001 182420828 1827 True 1916.0 1916 85.5690 268 2133 1 chr6A.!!$R1 1865

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
282 306 3.457234 CTTATGCAGTTATGGCTCGTCA 58.543 45.455 0.00 0.00 0.00 4.35 F
1410 4950 0.387929 TGTCTGTCGACCCACTTGAC 59.612 55.000 14.12 11.47 39.47 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1410 4950 5.771469 TCTTGTGTTATTGGCTTGTTGATG 58.229 37.50 0.0 0.0 0.0 3.07 R
2289 5835 5.715434 TGGTTTTCAATAGTAAGGGCAAC 57.285 39.13 0.0 0.0 0.0 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 7.439157 TTCTGATATGCAATTTTCCTATCCG 57.561 36.000 0.00 0.00 0.00 4.18
282 306 3.457234 CTTATGCAGTTATGGCTCGTCA 58.543 45.455 0.00 0.00 0.00 4.35
1410 4950 0.387929 TGTCTGTCGACCCACTTGAC 59.612 55.000 14.12 11.47 39.47 3.18
1417 4957 1.414550 TCGACCCACTTGACATCAACA 59.585 47.619 0.00 0.00 0.00 3.33
1427 4967 5.630680 CACTTGACATCAACAAGCCAATAAC 59.369 40.000 0.00 0.00 45.66 1.89
1587 5127 5.065474 GGCGCATTGAGGTATAAGTTGTTTA 59.935 40.000 10.83 0.00 0.00 2.01
1688 5230 5.095691 TCTCGTTTGCATTTGTTCTCTTC 57.904 39.130 0.00 0.00 0.00 2.87
2177 5720 4.857679 TGTACCTTGGTTACCTGTTGTTT 58.142 39.130 2.07 0.00 0.00 2.83
2283 5829 7.844779 AGGAGAAAGTAGTACCATTTCTATCCA 59.155 37.037 14.32 0.00 41.95 3.41
2289 5835 8.964476 AGTAGTACCATTTCTATCCATTGTTG 57.036 34.615 0.00 0.00 0.00 3.33
2298 5844 5.186256 TCTATCCATTGTTGTTGCCCTTA 57.814 39.130 0.00 0.00 0.00 2.69
2316 5862 6.015772 TGCCCTTACTATTGAAAACCAACTTC 60.016 38.462 0.00 0.00 37.63 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 8.773645 TCATATACAAATACAACTGCTGCATAC 58.226 33.333 1.31 0.00 0.00 2.39
282 306 1.144057 CGCCTCGCACTTAAGGGAT 59.856 57.895 9.50 0.00 32.98 3.85
1410 4950 5.771469 TCTTGTGTTATTGGCTTGTTGATG 58.229 37.500 0.00 0.00 0.00 3.07
1417 4957 8.177119 TCTAATGTTTCTTGTGTTATTGGCTT 57.823 30.769 0.00 0.00 0.00 4.35
1427 4967 7.361542 CCTCCATGTCTTCTAATGTTTCTTGTG 60.362 40.741 0.00 0.00 0.00 3.33
1629 5171 7.011389 GCTTGCAAATATAATTGAAAGGGAACC 59.989 37.037 18.91 2.87 43.43 3.62
2283 5829 6.909550 TTCAATAGTAAGGGCAACAACAAT 57.090 33.333 0.00 0.00 39.74 2.71
2289 5835 5.715434 TGGTTTTCAATAGTAAGGGCAAC 57.285 39.130 0.00 0.00 0.00 4.17
2298 5844 7.898014 AAGAAGGAAGTTGGTTTTCAATAGT 57.102 32.000 0.00 0.00 37.73 2.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.