Multiple sequence alignment - TraesCS3B01G523900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G523900 chr3B 100.000 2531 0 0 1 2531 766340270 766342800 0.000000e+00 4674
1 TraesCS3B01G523900 chr3B 86.225 1539 172 24 996 2529 473235219 473236722 0.000000e+00 1631
2 TraesCS3B01G523900 chr2B 94.022 2208 112 12 333 2531 528810830 528808634 0.000000e+00 3328
3 TraesCS3B01G523900 chr2B 96.413 1645 54 4 891 2531 419937780 419939423 0.000000e+00 2706
4 TraesCS3B01G523900 chr2B 90.000 520 39 9 330 848 419937268 419937775 0.000000e+00 660
5 TraesCS3B01G523900 chr2B 94.074 135 4 2 301 435 528810946 528810816 4.270000e-48 202
6 TraesCS3B01G523900 chr2B 91.781 146 7 4 293 438 419936959 419937099 5.520000e-47 198
7 TraesCS3B01G523900 chr7B 99.023 1740 15 2 793 2531 73167096 73168834 0.000000e+00 3118
8 TraesCS3B01G523900 chr7B 95.612 1641 59 3 891 2531 517901753 517903380 0.000000e+00 2619
9 TraesCS3B01G523900 chr7B 99.537 432 1 1 1 432 73166289 73166719 0.000000e+00 785
10 TraesCS3B01G523900 chr7D 97.141 1644 43 3 891 2531 83758190 83759832 0.000000e+00 2772
11 TraesCS3B01G523900 chr7D 90.962 520 31 10 330 848 83757681 83758185 0.000000e+00 686
12 TraesCS3B01G523900 chr7D 90.962 520 31 10 330 848 126714232 126714736 0.000000e+00 686
13 TraesCS3B01G523900 chr7D 90.909 517 31 10 333 848 366438534 366438033 0.000000e+00 680
14 TraesCS3B01G523900 chr7D 91.749 303 22 1 1 303 126713756 126714055 3.890000e-113 418
15 TraesCS3B01G523900 chr7D 91.419 303 23 1 1 303 366439013 366438714 1.810000e-111 412
16 TraesCS3B01G523900 chr6B 95.502 1645 57 11 891 2531 676682893 676684524 0.000000e+00 2612
17 TraesCS3B01G523900 chr6B 90.779 629 29 14 848 1452 138657751 138658374 0.000000e+00 813
18 TraesCS3B01G523900 chr6B 92.349 562 33 7 293 848 676682331 676682888 0.000000e+00 791
19 TraesCS3B01G523900 chr6B 94.389 303 16 1 1 303 676681973 676682274 4.930000e-127 464
20 TraesCS3B01G523900 chr6B 91.205 307 23 2 1 303 616984111 616984417 5.040000e-112 414
21 TraesCS3B01G523900 chr1B 95.045 1453 58 11 330 1779 344012240 344013681 0.000000e+00 2272
22 TraesCS3B01G523900 chr4B 95.433 1248 53 3 1285 2529 43574175 43572929 0.000000e+00 1986
23 TraesCS3B01G523900 chr4B 95.192 1248 56 3 1285 2529 43588041 43586795 0.000000e+00 1969
24 TraesCS3B01G523900 chr4B 94.266 994 51 4 296 1289 43592972 43591985 0.000000e+00 1515
25 TraesCS3B01G523900 chr4B 95.380 303 14 0 1 303 43593431 43593129 1.360000e-132 483
26 TraesCS3B01G523900 chr4B 94.406 143 6 1 296 438 43593069 43592929 4.240000e-53 219
27 TraesCS3B01G523900 chr4B 95.588 136 3 2 303 438 43593158 43593026 5.480000e-52 215
28 TraesCS3B01G523900 chr7A 87.967 1338 152 9 996 2329 126148078 126149410 0.000000e+00 1570
29 TraesCS3B01G523900 chr7A 95.281 445 7 7 1 435 447284741 447284301 0.000000e+00 693
30 TraesCS3B01G523900 chr2A 84.535 1539 178 28 996 2529 778648321 778649804 0.000000e+00 1469
31 TraesCS3B01G523900 chr2D 90.522 517 33 10 333 848 238092766 238092265 0.000000e+00 669
32 TraesCS3B01G523900 chr2D 90.461 304 25 3 1 303 238093151 238092851 5.070000e-107 398
33 TraesCS3B01G523900 chr6A 94.799 423 10 3 1 412 360534922 360534501 0.000000e+00 649


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G523900 chr3B 766340270 766342800 2530 False 4674.0 4674 100.000000 1 2531 1 chr3B.!!$F2 2530
1 TraesCS3B01G523900 chr3B 473235219 473236722 1503 False 1631.0 1631 86.225000 996 2529 1 chr3B.!!$F1 1533
2 TraesCS3B01G523900 chr2B 528808634 528810946 2312 True 1765.0 3328 94.048000 301 2531 2 chr2B.!!$R1 2230
3 TraesCS3B01G523900 chr2B 419936959 419939423 2464 False 1188.0 2706 92.731333 293 2531 3 chr2B.!!$F1 2238
4 TraesCS3B01G523900 chr7B 517901753 517903380 1627 False 2619.0 2619 95.612000 891 2531 1 chr7B.!!$F1 1640
5 TraesCS3B01G523900 chr7B 73166289 73168834 2545 False 1951.5 3118 99.280000 1 2531 2 chr7B.!!$F2 2530
6 TraesCS3B01G523900 chr7D 83757681 83759832 2151 False 1729.0 2772 94.051500 330 2531 2 chr7D.!!$F1 2201
7 TraesCS3B01G523900 chr7D 126713756 126714736 980 False 552.0 686 91.355500 1 848 2 chr7D.!!$F2 847
8 TraesCS3B01G523900 chr7D 366438033 366439013 980 True 546.0 680 91.164000 1 848 2 chr7D.!!$R1 847
9 TraesCS3B01G523900 chr6B 676681973 676684524 2551 False 1289.0 2612 94.080000 1 2531 3 chr6B.!!$F3 2530
10 TraesCS3B01G523900 chr6B 138657751 138658374 623 False 813.0 813 90.779000 848 1452 1 chr6B.!!$F1 604
11 TraesCS3B01G523900 chr1B 344012240 344013681 1441 False 2272.0 2272 95.045000 330 1779 1 chr1B.!!$F1 1449
12 TraesCS3B01G523900 chr4B 43572929 43574175 1246 True 1986.0 1986 95.433000 1285 2529 1 chr4B.!!$R1 1244
13 TraesCS3B01G523900 chr4B 43586795 43593431 6636 True 880.2 1969 94.966400 1 2529 5 chr4B.!!$R2 2528
14 TraesCS3B01G523900 chr7A 126148078 126149410 1332 False 1570.0 1570 87.967000 996 2329 1 chr7A.!!$F1 1333
15 TraesCS3B01G523900 chr2A 778648321 778649804 1483 False 1469.0 1469 84.535000 996 2529 1 chr2A.!!$F1 1533
16 TraesCS3B01G523900 chr2D 238092265 238093151 886 True 533.5 669 90.491500 1 848 2 chr2D.!!$R1 847

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
521 900 6.809196 GTGTTCTTGATCTGTCTAGTTAGGTG 59.191 42.308 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2138 6508 5.771469 TCTTGTGTTATTGGCTTGTTGATG 58.229 37.5 0.0 0.0 0.0 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 299 7.908827 TGAAGTACAAAAATATGCGTCCTTA 57.091 32.000 0.00 0.00 0.00 2.69
521 900 6.809196 GTGTTCTTGATCTGTCTAGTTAGGTG 59.191 42.308 0.00 0.00 0.00 4.00
544 923 8.150945 GGTGACTAGGCAAATAGATGAATTAGA 58.849 37.037 0.00 0.00 0.00 2.10
754 1135 7.439157 TTCTGATATGCAATTTTCCTATCCG 57.561 36.000 0.00 0.00 0.00 4.18
1010 1414 3.457234 CTTATGCAGTTATGGCTCGTCA 58.543 45.455 0.00 0.00 0.00 4.35
2138 6508 0.387929 TGTCTGTCGACCCACTTGAC 59.612 55.000 14.12 11.47 39.47 3.18
2145 6515 1.414550 TCGACCCACTTGACATCAACA 59.585 47.619 0.00 0.00 0.00 3.33
2155 6525 5.630680 CACTTGACATCAACAAGCCAATAAC 59.369 40.000 0.00 0.00 45.66 1.89
2315 6685 5.065474 GGCGCATTGAGGTATAAGTTGTTTA 59.935 40.000 10.83 0.00 0.00 2.01
2416 6812 5.095691 TCTCGTTTGCATTTGTTCTCTTC 57.904 39.130 0.00 0.00 0.00 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
544 923 2.676748 TCCTTTTTGTGACCAGCCAAT 58.323 42.857 0.00 0.00 0.00 3.16
754 1135 8.773645 TCATATACAAATACAACTGCTGCATAC 58.226 33.333 1.31 0.00 0.00 2.39
1010 1414 1.144057 CGCCTCGCACTTAAGGGAT 59.856 57.895 9.50 0.00 32.98 3.85
2138 6508 5.771469 TCTTGTGTTATTGGCTTGTTGATG 58.229 37.500 0.00 0.00 0.00 3.07
2145 6515 8.177119 TCTAATGTTTCTTGTGTTATTGGCTT 57.823 30.769 0.00 0.00 0.00 4.35
2155 6525 7.361542 CCTCCATGTCTTCTAATGTTTCTTGTG 60.362 40.741 0.00 0.00 0.00 3.33
2357 6753 7.011389 GCTTGCAAATATAATTGAAAGGGAACC 59.989 37.037 18.91 2.87 43.43 3.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.