Multiple sequence alignment - TraesCS3B01G514300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G514300 chr3B 100.000 3440 0 0 1 3440 756825167 756821728 0.000000e+00 6353
1 TraesCS3B01G514300 chr3B 99.406 3031 17 1 410 3440 756709626 756706597 0.000000e+00 5496
2 TraesCS3B01G514300 chr3B 99.181 1710 14 0 1731 3440 756743826 756742117 0.000000e+00 3081
3 TraesCS3B01G514300 chr3B 99.181 1710 14 0 1731 3440 756788429 756786720 0.000000e+00 3081
4 TraesCS3B01G514300 chr3B 85.870 1196 166 2 1239 2432 756589165 756590359 0.000000e+00 1269
5 TraesCS3B01G514300 chr3B 85.786 1196 167 2 1239 2432 756602549 756603743 0.000000e+00 1264
6 TraesCS3B01G514300 chr3B 100.000 376 0 0 1 376 756710753 756710378 0.000000e+00 695
7 TraesCS3B01G514300 chr3B 100.000 376 0 0 1 376 756744725 756744350 0.000000e+00 695
8 TraesCS3B01G514300 chr3B 79.663 831 129 19 830 1627 756627664 756628487 2.320000e-156 562
9 TraesCS3B01G514300 chr3B 96.667 180 6 0 3261 3440 118882363 118882184 2.010000e-77 300
10 TraesCS3B01G514300 chr3B 96.129 155 6 0 691 845 756626064 756626218 1.580000e-63 254
11 TraesCS3B01G514300 chr3B 82.979 141 16 6 984 1119 684748124 684748261 1.680000e-23 121
12 TraesCS3B01G514300 chr3D 91.427 2088 146 16 662 2735 570146925 570144857 0.000000e+00 2833
13 TraesCS3B01G514300 chr3D 85.703 1266 172 7 1232 2492 568088208 568086947 0.000000e+00 1327
14 TraesCS3B01G514300 chr3D 90.785 662 41 10 3 652 570147719 570147066 0.000000e+00 867
15 TraesCS3B01G514300 chr3D 82.270 141 18 5 984 1119 520323413 520323275 7.800000e-22 115
16 TraesCS3B01G514300 chr3D 82.645 121 14 4 2926 3041 570144578 570144460 2.180000e-17 100
17 TraesCS3B01G514300 chrUn 85.839 1264 173 5 1232 2492 264010657 264009397 0.000000e+00 1338
18 TraesCS3B01G514300 chrUn 85.839 1264 173 5 1232 2492 294197131 294195871 0.000000e+00 1338
19 TraesCS3B01G514300 chrUn 100.000 376 0 0 1 376 364553821 364554196 0.000000e+00 695
20 TraesCS3B01G514300 chr3A 85.680 1264 173 6 1233 2492 702491458 702492717 0.000000e+00 1325
21 TraesCS3B01G514300 chr3A 89.394 132 14 0 947 1078 702917743 702917612 2.120000e-37 167
22 TraesCS3B01G514300 chr3A 84.733 131 13 6 995 1120 655627892 655628020 1.300000e-24 124
23 TraesCS3B01G514300 chr3A 80.519 154 24 4 947 1095 702952868 702952716 2.810000e-21 113
24 TraesCS3B01G514300 chr3A 82.308 130 16 6 995 1119 655899505 655899378 4.700000e-19 106
25 TraesCS3B01G514300 chr1A 81.520 1342 211 19 1208 2541 14109434 14108122 0.000000e+00 1070
26 TraesCS3B01G514300 chr6B 96.703 182 6 0 3259 3440 166031831 166032012 1.550000e-78 303
27 TraesCS3B01G514300 chr6B 95.745 188 6 2 3253 3440 114307927 114307742 5.580000e-78 302
28 TraesCS3B01G514300 chr1B 96.703 182 6 0 3259 3440 154316529 154316348 1.550000e-78 303
29 TraesCS3B01G514300 chr1B 95.628 183 8 0 3258 3440 553496992 553497174 9.340000e-76 294
30 TraesCS3B01G514300 chr2B 96.648 179 6 0 3261 3439 75326551 75326729 7.220000e-77 298


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G514300 chr3B 756821728 756825167 3439 True 6353.000000 6353 100.000000 1 3440 1 chr3B.!!$R3 3439
1 TraesCS3B01G514300 chr3B 756706597 756710753 4156 True 3095.500000 5496 99.703000 1 3440 2 chr3B.!!$R4 3439
2 TraesCS3B01G514300 chr3B 756786720 756788429 1709 True 3081.000000 3081 99.181000 1731 3440 1 chr3B.!!$R2 1709
3 TraesCS3B01G514300 chr3B 756742117 756744725 2608 True 1888.000000 3081 99.590500 1 3440 2 chr3B.!!$R5 3439
4 TraesCS3B01G514300 chr3B 756589165 756590359 1194 False 1269.000000 1269 85.870000 1239 2432 1 chr3B.!!$F2 1193
5 TraesCS3B01G514300 chr3B 756602549 756603743 1194 False 1264.000000 1264 85.786000 1239 2432 1 chr3B.!!$F3 1193
6 TraesCS3B01G514300 chr3B 756626064 756628487 2423 False 408.000000 562 87.896000 691 1627 2 chr3B.!!$F4 936
7 TraesCS3B01G514300 chr3D 568086947 568088208 1261 True 1327.000000 1327 85.703000 1232 2492 1 chr3D.!!$R2 1260
8 TraesCS3B01G514300 chr3D 570144460 570147719 3259 True 1266.666667 2833 88.285667 3 3041 3 chr3D.!!$R3 3038
9 TraesCS3B01G514300 chrUn 264009397 264010657 1260 True 1338.000000 1338 85.839000 1232 2492 1 chrUn.!!$R1 1260
10 TraesCS3B01G514300 chrUn 294195871 294197131 1260 True 1338.000000 1338 85.839000 1232 2492 1 chrUn.!!$R2 1260
11 TraesCS3B01G514300 chr3A 702491458 702492717 1259 False 1325.000000 1325 85.680000 1233 2492 1 chr3A.!!$F2 1259
12 TraesCS3B01G514300 chr1A 14108122 14109434 1312 True 1070.000000 1070 81.520000 1208 2541 1 chr1A.!!$R1 1333

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
407 415 0.175073 ATGCCTCGAGGTAACGTTCC 59.825 55.000 31.43 13.40 46.39 3.62 F
408 416 0.896940 TGCCTCGAGGTAACGTTCCT 60.897 55.000 31.43 16.13 46.39 3.36 F
2160 4524 1.605451 TTCCGGCGAAGAGGTGAGA 60.605 57.895 9.30 0.00 0.00 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2160 4524 5.190357 AGCCCTCTTCTTCAATGATTTCT 57.810 39.130 0.0 0.0 0.00 2.52 R
2408 4772 1.883084 GCGAGGGATACAACCAGCG 60.883 63.158 0.0 0.0 39.74 5.18 R
3109 5594 1.588082 CCATGGCTTGTTGTCTGGC 59.412 57.895 0.0 0.0 0.00 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
402 410 3.969995 GAGGATGCCTCGAGGTAAC 57.030 57.895 31.43 25.30 41.08 2.50
407 415 0.175073 ATGCCTCGAGGTAACGTTCC 59.825 55.000 31.43 13.40 46.39 3.62
408 416 0.896940 TGCCTCGAGGTAACGTTCCT 60.897 55.000 31.43 16.13 46.39 3.36
2160 4524 1.605451 TTCCGGCGAAGAGGTGAGA 60.605 57.895 9.30 0.00 0.00 3.27
2408 4772 0.101579 GCCAGAACCTCTCGAGCTAC 59.898 60.000 7.81 0.00 0.00 3.58
3185 5670 7.867403 TCAAATTTGAGTAACCAAAGCTCATTC 59.133 33.333 16.91 0.00 39.13 2.67
3354 5839 5.968528 AGATACAAGACTCAAGACTTCGT 57.031 39.130 0.00 0.00 0.00 3.85
3357 5842 2.959707 ACAAGACTCAAGACTTCGTCCT 59.040 45.455 9.46 0.00 32.18 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
402 410 4.813296 AGCAAACAAGTTAAGAGGAACG 57.187 40.909 0.00 0.00 34.36 3.95
407 415 6.037610 ACAGAGACAAGCAAACAAGTTAAGAG 59.962 38.462 0.00 0.00 0.00 2.85
408 416 5.880332 ACAGAGACAAGCAAACAAGTTAAGA 59.120 36.000 0.00 0.00 0.00 2.10
2160 4524 5.190357 AGCCCTCTTCTTCAATGATTTCT 57.810 39.130 0.00 0.00 0.00 2.52
2408 4772 1.883084 GCGAGGGATACAACCAGCG 60.883 63.158 0.00 0.00 39.74 5.18
2910 5390 4.908601 TTAAGCATCACAAGGAAGGAGA 57.091 40.909 0.00 0.00 0.00 3.71
3030 5515 1.838913 CGTTGCCAAGACAAAACCAG 58.161 50.000 0.00 0.00 0.00 4.00
3109 5594 1.588082 CCATGGCTTGTTGTCTGGC 59.412 57.895 0.00 0.00 0.00 4.85
3185 5670 5.063880 CCGGATAAGGAATCTTTAACTGGG 58.936 45.833 10.96 2.11 34.75 4.45
3354 5839 2.447920 TCCCATCCGGACACAGGA 59.552 61.111 6.12 8.01 42.69 3.86
3398 5883 3.564225 GGAAACACAATATCCGGATCACC 59.436 47.826 23.08 8.35 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.