Multiple sequence alignment - TraesCS3B01G513900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G513900 chr3B 100.000 2547 0 0 1 2547 756709143 756706597 0.000000e+00 4704
1 TraesCS3B01G513900 chr3B 99.294 2548 17 1 1 2547 756824275 756821728 0.000000e+00 4604
2 TraesCS3B01G513900 chr3B 99.825 1710 3 0 838 2547 756743826 756742117 0.000000e+00 3142
3 TraesCS3B01G513900 chr3B 99.825 1710 3 0 838 2547 756788429 756786720 0.000000e+00 3142
4 TraesCS3B01G513900 chr3B 85.870 1196 165 3 347 1539 756589165 756590359 0.000000e+00 1269
5 TraesCS3B01G513900 chr3B 78.255 768 126 20 1 734 756627727 756628487 2.990000e-124 455
6 TraesCS3B01G513900 chr3B 93.158 190 13 0 2358 2547 519365679 519365490 1.930000e-71 279
7 TraesCS3B01G513900 chr3B 82.979 141 16 6 92 227 684748124 684748261 1.240000e-23 121
8 TraesCS3B01G513900 chr3D 92.249 1845 133 6 5 1842 570146698 570144857 0.000000e+00 2606
9 TraesCS3B01G513900 chr3D 85.601 1264 176 5 340 1599 568088208 568086947 0.000000e+00 1321
10 TraesCS3B01G513900 chr3D 82.270 141 18 5 92 227 520323413 520323275 5.760000e-22 115
11 TraesCS3B01G513900 chr3D 82.645 121 14 4 2033 2148 570144578 570144460 1.610000e-17 100
12 TraesCS3B01G513900 chrUn 85.839 1264 172 6 340 1599 264010657 264009397 0.000000e+00 1336
13 TraesCS3B01G513900 chrUn 85.839 1264 172 6 340 1599 294197131 294195871 0.000000e+00 1336
14 TraesCS3B01G513900 chr3A 85.601 1264 173 7 341 1599 702491458 702492717 0.000000e+00 1317
15 TraesCS3B01G513900 chr3A 89.394 132 14 0 55 186 702917743 702917612 1.570000e-37 167
16 TraesCS3B01G513900 chr3A 84.733 131 13 6 103 228 655627892 655628020 9.570000e-25 124
17 TraesCS3B01G513900 chr3A 80.519 154 24 4 55 203 702952868 702952716 2.070000e-21 113
18 TraesCS3B01G513900 chr3A 82.308 130 16 6 103 227 655899505 655899378 3.470000e-19 106
19 TraesCS3B01G513900 chr1A 81.446 1342 211 20 316 1648 14109434 14108122 0.000000e+00 1064
20 TraesCS3B01G513900 chr1D 81.995 1233 193 18 316 1539 12179500 12178288 0.000000e+00 1020
21 TraesCS3B01G513900 chr2B 96.111 180 7 0 2368 2547 371776966 371777145 6.890000e-76 294
22 TraesCS3B01G513900 chr6B 95.604 182 8 0 2366 2547 166031831 166032012 2.480000e-75 292
23 TraesCS3B01G513900 chr6B 94.681 188 8 2 2360 2547 114307927 114307742 8.910000e-75 291
24 TraesCS3B01G513900 chr2D 95.580 181 8 0 2367 2547 615921264 615921084 8.910000e-75 291
25 TraesCS3B01G513900 chr4B 95.556 180 8 0 2368 2547 284158977 284159156 3.210000e-74 289


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G513900 chr3B 756706597 756709143 2546 True 4704 4704 100.000 1 2547 1 chr3B.!!$R2 2546
1 TraesCS3B01G513900 chr3B 756821728 756824275 2547 True 4604 4604 99.294 1 2547 1 chr3B.!!$R5 2546
2 TraesCS3B01G513900 chr3B 756742117 756743826 1709 True 3142 3142 99.825 838 2547 1 chr3B.!!$R3 1709
3 TraesCS3B01G513900 chr3B 756786720 756788429 1709 True 3142 3142 99.825 838 2547 1 chr3B.!!$R4 1709
4 TraesCS3B01G513900 chr3B 756589165 756590359 1194 False 1269 1269 85.870 347 1539 1 chr3B.!!$F2 1192
5 TraesCS3B01G513900 chr3B 756627727 756628487 760 False 455 455 78.255 1 734 1 chr3B.!!$F3 733
6 TraesCS3B01G513900 chr3D 570144460 570146698 2238 True 1353 2606 87.447 5 2148 2 chr3D.!!$R3 2143
7 TraesCS3B01G513900 chr3D 568086947 568088208 1261 True 1321 1321 85.601 340 1599 1 chr3D.!!$R2 1259
8 TraesCS3B01G513900 chrUn 264009397 264010657 1260 True 1336 1336 85.839 340 1599 1 chrUn.!!$R1 1259
9 TraesCS3B01G513900 chrUn 294195871 294197131 1260 True 1336 1336 85.839 340 1599 1 chrUn.!!$R2 1259
10 TraesCS3B01G513900 chr3A 702491458 702492717 1259 False 1317 1317 85.601 341 1599 1 chr3A.!!$F2 1258
11 TraesCS3B01G513900 chr1A 14108122 14109434 1312 True 1064 1064 81.446 316 1648 1 chr1A.!!$R1 1332
12 TraesCS3B01G513900 chr1D 12178288 12179500 1212 True 1020 1020 81.995 316 1539 1 chr1D.!!$R1 1223

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
643 670 1.271597 GGTGGTGAAGAGCTTGGTCAT 60.272 52.381 2.64 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2512 2672 9.349713 GTTATATGGAAGGAAACACAATATCCA 57.65 33.333 0.0 0.0 39.59 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
643 670 1.271597 GGTGGTGAAGAGCTTGGTCAT 60.272 52.381 2.64 0.0 0.00 3.06
2512 2672 4.619394 CGTGGAAGACAAGCTTAGTGATCT 60.619 45.833 0.00 0.0 36.83 2.75
2534 2694 7.206789 TCTGGATATTGTGTTTCCTTCCATA 57.793 36.000 0.00 0.0 31.79 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
836 873 5.221067 CGATTTCTCGTTAGATCCTCAGGAA 60.221 44.000 0.0 0.0 40.07 3.36
2512 2672 9.349713 GTTATATGGAAGGAAACACAATATCCA 57.650 33.333 0.0 0.0 39.59 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.