Multiple sequence alignment - TraesCS3B01G510700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G510700 chr3B 100.000 3243 0 0 1 3243 754873453 754876695 0.000000e+00 5989
1 TraesCS3B01G510700 chr3B 91.538 260 20 1 657 916 606370941 606371198 1.110000e-94 357
2 TraesCS3B01G510700 chr3B 94.167 240 3 1 32 271 754857326 754857554 3.980000e-94 355
3 TraesCS3B01G510700 chr3B 94.472 199 9 1 440 638 606370756 606370952 4.060000e-79 305
4 TraesCS3B01G510700 chr3B 78.151 238 29 21 1 224 713435177 713434949 2.630000e-26 130
5 TraesCS3B01G510700 chr4B 99.341 2277 14 1 968 3243 660883255 660880979 0.000000e+00 4120
6 TraesCS3B01G510700 chr7A 99.211 2281 16 2 965 3243 692046165 692048445 0.000000e+00 4111
7 TraesCS3B01G510700 chr7A 96.237 1382 43 4 1141 2515 91013041 91011662 0.000000e+00 2255
8 TraesCS3B01G510700 chr7A 97.425 738 18 1 2507 3243 718437629 718436892 0.000000e+00 1256
9 TraesCS3B01G510700 chr7A 97.596 208 4 1 968 1175 186400679 186400473 3.980000e-94 355
10 TraesCS3B01G510700 chr7A 97.596 208 4 1 968 1175 718439395 718439189 3.980000e-94 355
11 TraesCS3B01G510700 chr2A 99.079 2280 19 2 965 3243 41757461 41759739 0.000000e+00 4093
12 TraesCS3B01G510700 chr3A 98.991 2280 22 1 965 3243 720983579 720985858 0.000000e+00 4082
13 TraesCS3B01G510700 chr3A 98.972 1654 16 1 1591 3243 721021135 721022788 0.000000e+00 2959
14 TraesCS3B01G510700 chr3A 95.543 359 16 0 271 629 212102735 212102377 2.810000e-160 575
15 TraesCS3B01G510700 chr3A 94.150 359 21 0 271 629 616599187 616598829 6.120000e-152 547
16 TraesCS3B01G510700 chr3A 89.683 252 23 2 658 909 212102287 212102039 5.220000e-83 318
17 TraesCS3B01G510700 chr3A 89.080 174 17 1 658 831 616598739 616598568 7.050000e-52 215
18 TraesCS3B01G510700 chrUn 98.990 2278 19 4 968 3243 48295924 48293649 0.000000e+00 4076
19 TraesCS3B01G510700 chrUn 99.777 1345 3 0 965 2309 271466800 271468144 0.000000e+00 2468
20 TraesCS3B01G510700 chrUn 99.588 972 4 0 1 972 271465518 271466489 0.000000e+00 1773
21 TraesCS3B01G510700 chrUn 97.939 922 17 1 1 922 315600522 315599603 0.000000e+00 1596
22 TraesCS3B01G510700 chrUn 93.750 240 4 1 32 271 40877161 40876933 1.850000e-92 350
23 TraesCS3B01G510700 chr5A 96.382 1382 41 4 1141 2515 565690236 565688857 0.000000e+00 2266
24 TraesCS3B01G510700 chr5A 97.425 738 18 1 2507 3243 565688686 565687949 0.000000e+00 1256
25 TraesCS3B01G510700 chr7B 97.811 731 16 0 2513 3243 714303674 714304404 0.000000e+00 1262
26 TraesCS3B01G510700 chr1A 95.506 356 16 0 271 626 506336001 506336356 1.310000e-158 569
27 TraesCS3B01G510700 chr1A 91.270 252 20 1 658 909 506336449 506336698 3.100000e-90 342
28 TraesCS3B01G510700 chr6B 93.261 371 24 1 271 641 81582661 81583030 2.200000e-151 545
29 TraesCS3B01G510700 chr6B 88.346 266 29 1 657 922 81583016 81583279 5.220000e-83 318
30 TraesCS3B01G510700 chr6B 92.118 203 12 1 271 469 513992037 513992239 1.900000e-72 283
31 TraesCS3B01G510700 chr4A 97.048 271 6 1 1 271 649011029 649010761 3.810000e-124 455
32 TraesCS3B01G510700 chr4A 98.333 240 4 0 32 271 649015986 649015747 3.870000e-114 422
33 TraesCS3B01G510700 chr2D 78.862 246 28 21 1 232 651164610 651164375 9.380000e-31 145
34 TraesCS3B01G510700 chr5B 78.723 235 25 21 1 223 196387743 196387522 2.030000e-27 134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G510700 chr3B 754873453 754876695 3242 False 5989.0 5989 100.0000 1 3243 1 chr3B.!!$F2 3242
1 TraesCS3B01G510700 chr4B 660880979 660883255 2276 True 4120.0 4120 99.3410 968 3243 1 chr4B.!!$R1 2275
2 TraesCS3B01G510700 chr7A 692046165 692048445 2280 False 4111.0 4111 99.2110 965 3243 1 chr7A.!!$F1 2278
3 TraesCS3B01G510700 chr7A 91011662 91013041 1379 True 2255.0 2255 96.2370 1141 2515 1 chr7A.!!$R1 1374
4 TraesCS3B01G510700 chr7A 718436892 718439395 2503 True 805.5 1256 97.5105 968 3243 2 chr7A.!!$R3 2275
5 TraesCS3B01G510700 chr2A 41757461 41759739 2278 False 4093.0 4093 99.0790 965 3243 1 chr2A.!!$F1 2278
6 TraesCS3B01G510700 chr3A 720983579 720985858 2279 False 4082.0 4082 98.9910 965 3243 1 chr3A.!!$F1 2278
7 TraesCS3B01G510700 chr3A 721021135 721022788 1653 False 2959.0 2959 98.9720 1591 3243 1 chr3A.!!$F2 1652
8 TraesCS3B01G510700 chr3A 212102039 212102735 696 True 446.5 575 92.6130 271 909 2 chr3A.!!$R1 638
9 TraesCS3B01G510700 chr3A 616598568 616599187 619 True 381.0 547 91.6150 271 831 2 chr3A.!!$R2 560
10 TraesCS3B01G510700 chrUn 48293649 48295924 2275 True 4076.0 4076 98.9900 968 3243 1 chrUn.!!$R2 2275
11 TraesCS3B01G510700 chrUn 271465518 271468144 2626 False 2120.5 2468 99.6825 1 2309 2 chrUn.!!$F1 2308
12 TraesCS3B01G510700 chrUn 315599603 315600522 919 True 1596.0 1596 97.9390 1 922 1 chrUn.!!$R3 921
13 TraesCS3B01G510700 chr5A 565687949 565690236 2287 True 1761.0 2266 96.9035 1141 3243 2 chr5A.!!$R1 2102
14 TraesCS3B01G510700 chr7B 714303674 714304404 730 False 1262.0 1262 97.8110 2513 3243 1 chr7B.!!$F1 730
15 TraesCS3B01G510700 chr1A 506336001 506336698 697 False 455.5 569 93.3880 271 909 2 chr1A.!!$F1 638
16 TraesCS3B01G510700 chr6B 81582661 81583279 618 False 431.5 545 90.8035 271 922 2 chr6B.!!$F2 651

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
845 846 3.219928 ATCGCATCCGCCTCGTCT 61.22 61.111 0.0 0.0 33.11 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2561 3335 3.149196 CAACATAGACACAAACAGCCCT 58.851 45.455 0.0 0.0 0.0 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
845 846 3.219928 ATCGCATCCGCCTCGTCT 61.220 61.111 0.0 0.0 33.11 4.18
2365 2958 3.326297 ACTTTCTATCCATGCCTAGCCTC 59.674 47.826 0.0 0.0 0.00 4.70
2527 3301 6.015434 ACACCATCCTGATTTTCCTTTTGTAC 60.015 38.462 0.0 0.0 0.00 2.90
2561 3335 3.935993 GCTAGTCCAAGCCAACAGA 57.064 52.632 0.0 0.0 36.45 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2365 2958 4.159377 ACATTGCTTAACATGACAACGG 57.841 40.909 0.00 0.0 0.00 4.44
2527 3301 4.437390 GGACTAGCCATTTGTCAATTGTCG 60.437 45.833 5.13 0.0 33.84 4.35
2561 3335 3.149196 CAACATAGACACAAACAGCCCT 58.851 45.455 0.00 0.0 0.00 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.