Multiple sequence alignment - TraesCS3B01G473400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G473400 chr3B 100.000 3069 0 0 1 3069 722567327 722564259 0.000000e+00 5668.0
1 TraesCS3B01G473400 chr3B 97.574 2432 48 1 1 2421 39884872 39882441 0.000000e+00 4154.0
2 TraesCS3B01G473400 chr3B 96.048 2429 83 3 1 2418 176165684 176168110 0.000000e+00 3941.0
3 TraesCS3B01G473400 chr3B 100.000 46 0 0 2415 2460 39882415 39882370 5.450000e-13 86.1
4 TraesCS3B01G473400 chr3B 100.000 28 0 0 2221 2248 39882682 39882655 6.000000e-03 52.8
5 TraesCS3B01G473400 chr2B 96.957 2432 63 1 1 2421 697736234 697733803 0.000000e+00 4071.0
6 TraesCS3B01G473400 chr2B 97.448 1293 30 3 1128 2418 38158073 38159364 0.000000e+00 2202.0
7 TraesCS3B01G473400 chr2B 95.884 1142 34 3 1 1131 38097362 38098501 0.000000e+00 1836.0
8 TraesCS3B01G473400 chr2B 95.225 1131 35 9 1 1131 38145933 38147044 0.000000e+00 1772.0
9 TraesCS3B01G473400 chr2B 97.347 867 22 1 1508 2373 38111217 38112083 0.000000e+00 1472.0
10 TraesCS3B01G473400 chr2B 94.737 57 3 0 2405 2461 697733787 697733731 4.210000e-14 89.8
11 TraesCS3B01G473400 chr2B 100.000 46 0 0 2415 2460 38159393 38159438 5.450000e-13 86.1
12 TraesCS3B01G473400 chr2A 94.663 2492 99 15 1 2460 79273058 79270569 0.000000e+00 3834.0
13 TraesCS3B01G473400 chr5A 94.957 2439 92 4 1 2421 595563994 595561569 0.000000e+00 3794.0
14 TraesCS3B01G473400 chr5A 100.000 47 0 0 2415 2461 595561543 595561497 1.520000e-13 87.9
15 TraesCS3B01G473400 chr1A 94.021 2492 109 18 1 2460 88195985 88198468 0.000000e+00 3740.0
16 TraesCS3B01G473400 chr6D 96.903 2131 55 1 1 2120 431077574 431075444 0.000000e+00 3559.0
17 TraesCS3B01G473400 chr6D 96.387 2131 66 1 1 2120 419417545 419419675 0.000000e+00 3498.0
18 TraesCS3B01G473400 chr6D 96.336 2129 62 4 3 2120 327573651 327571528 0.000000e+00 3485.0
19 TraesCS3B01G473400 chr6D 96.246 2131 69 1 1 2120 12091225 12093355 0.000000e+00 3482.0
20 TraesCS3B01G473400 chr6D 94.355 248 14 0 2163 2410 431075443 431075196 6.210000e-102 381.0
21 TraesCS3B01G473400 chr6D 94.313 211 12 0 2163 2373 12093356 12093566 1.060000e-84 324.0
22 TraesCS3B01G473400 chr6D 92.982 57 4 0 2405 2461 419419950 419420006 1.960000e-12 84.2
23 TraesCS3B01G473400 chr6B 95.090 611 28 1 2461 3069 180997552 180996942 0.000000e+00 961.0
24 TraesCS3B01G473400 chr6B 94.850 602 30 1 2461 3061 43447737 43447136 0.000000e+00 939.0
25 TraesCS3B01G473400 chr6B 94.426 610 33 1 2461 3069 180989738 180989129 0.000000e+00 937.0
26 TraesCS3B01G473400 chr4B 94.426 610 33 1 2461 3069 631475901 631475292 0.000000e+00 937.0
27 TraesCS3B01G473400 chr4B 94.262 610 34 1 2461 3069 495681550 495682159 0.000000e+00 931.0
28 TraesCS3B01G473400 chr4B 94.127 613 32 4 2461 3069 302874009 302873397 0.000000e+00 929.0
29 TraesCS3B01G473400 chr4B 94.262 610 32 3 2463 3069 515930830 515931439 0.000000e+00 929.0
30 TraesCS3B01G473400 chr1B 94.272 611 33 1 2461 3069 338683702 338683092 0.000000e+00 933.0
31 TraesCS3B01G473400 chr7B 94.272 611 32 3 2461 3069 344105000 344105609 0.000000e+00 931.0
32 TraesCS3B01G473400 chr1D 94.737 57 3 0 2405 2461 490873310 490873366 4.210000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G473400 chr3B 722564259 722567327 3068 True 5668.000000 5668 100.000000 1 3069 1 chr3B.!!$R1 3068
1 TraesCS3B01G473400 chr3B 176165684 176168110 2426 False 3941.000000 3941 96.048000 1 2418 1 chr3B.!!$F1 2417
2 TraesCS3B01G473400 chr3B 39882370 39884872 2502 True 1430.966667 4154 99.191333 1 2460 3 chr3B.!!$R2 2459
3 TraesCS3B01G473400 chr2B 697733731 697736234 2503 True 2080.400000 4071 95.847000 1 2461 2 chr2B.!!$R1 2460
4 TraesCS3B01G473400 chr2B 38097362 38098501 1139 False 1836.000000 1836 95.884000 1 1131 1 chr2B.!!$F1 1130
5 TraesCS3B01G473400 chr2B 38145933 38147044 1111 False 1772.000000 1772 95.225000 1 1131 1 chr2B.!!$F3 1130
6 TraesCS3B01G473400 chr2B 38111217 38112083 866 False 1472.000000 1472 97.347000 1508 2373 1 chr2B.!!$F2 865
7 TraesCS3B01G473400 chr2B 38158073 38159438 1365 False 1144.050000 2202 98.724000 1128 2460 2 chr2B.!!$F4 1332
8 TraesCS3B01G473400 chr2A 79270569 79273058 2489 True 3834.000000 3834 94.663000 1 2460 1 chr2A.!!$R1 2459
9 TraesCS3B01G473400 chr5A 595561497 595563994 2497 True 1940.950000 3794 97.478500 1 2461 2 chr5A.!!$R1 2460
10 TraesCS3B01G473400 chr1A 88195985 88198468 2483 False 3740.000000 3740 94.021000 1 2460 1 chr1A.!!$F1 2459
11 TraesCS3B01G473400 chr6D 327571528 327573651 2123 True 3485.000000 3485 96.336000 3 2120 1 chr6D.!!$R1 2117
12 TraesCS3B01G473400 chr6D 431075196 431077574 2378 True 1970.000000 3559 95.629000 1 2410 2 chr6D.!!$R2 2409
13 TraesCS3B01G473400 chr6D 12091225 12093566 2341 False 1903.000000 3482 95.279500 1 2373 2 chr6D.!!$F1 2372
14 TraesCS3B01G473400 chr6D 419417545 419420006 2461 False 1791.100000 3498 94.684500 1 2461 2 chr6D.!!$F2 2460
15 TraesCS3B01G473400 chr6B 180996942 180997552 610 True 961.000000 961 95.090000 2461 3069 1 chr6B.!!$R3 608
16 TraesCS3B01G473400 chr6B 43447136 43447737 601 True 939.000000 939 94.850000 2461 3061 1 chr6B.!!$R1 600
17 TraesCS3B01G473400 chr6B 180989129 180989738 609 True 937.000000 937 94.426000 2461 3069 1 chr6B.!!$R2 608
18 TraesCS3B01G473400 chr4B 631475292 631475901 609 True 937.000000 937 94.426000 2461 3069 1 chr4B.!!$R2 608
19 TraesCS3B01G473400 chr4B 495681550 495682159 609 False 931.000000 931 94.262000 2461 3069 1 chr4B.!!$F1 608
20 TraesCS3B01G473400 chr4B 302873397 302874009 612 True 929.000000 929 94.127000 2461 3069 1 chr4B.!!$R1 608
21 TraesCS3B01G473400 chr4B 515930830 515931439 609 False 929.000000 929 94.262000 2463 3069 1 chr4B.!!$F2 606
22 TraesCS3B01G473400 chr1B 338683092 338683702 610 True 933.000000 933 94.272000 2461 3069 1 chr1B.!!$R1 608
23 TraesCS3B01G473400 chr7B 344105000 344105609 609 False 931.000000 931 94.272000 2461 3069 1 chr7B.!!$F1 608

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
659 660 0.110486 TTGGGAAGCTTGGACCAGTC 59.89 55.0 2.1 0.0 33.96 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2196 2216 0.396435 ACATTGGACCGTCTCAAGCA 59.604 50.0 0.0 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 2.757868 TGTTCGCAATAATCAAAGGGGG 59.242 45.455 0.00 0.0 0.00 5.40
346 347 1.464608 CACAGGTTGCACGGTTATGAG 59.535 52.381 0.00 0.0 0.00 2.90
659 660 0.110486 TTGGGAAGCTTGGACCAGTC 59.890 55.000 2.10 0.0 33.96 3.51
962 963 6.815089 TGTTGACATGGCTGTTAATTTCTTT 58.185 32.000 0.00 0.0 33.93 2.52
1024 1036 4.210331 GTTCCTGCTCCATGGATTAATGT 58.790 43.478 16.63 0.0 31.76 2.71
1071 1083 7.186570 TGTGAGGTTTGATAATGATGAGAGA 57.813 36.000 0.00 0.0 0.00 3.10
1356 1368 5.847304 AGGCAAAGGAGAAACAAGAATTTC 58.153 37.500 0.00 0.0 38.62 2.17
1459 1471 0.602562 GTGCAGCAAAATGGTGGCTA 59.397 50.000 11.07 0.0 45.26 3.93
1667 1680 9.403583 TGAACTTTTAGGTTCATACAAAGAAGT 57.596 29.630 3.61 0.0 46.91 3.01
1678 1691 6.649155 TCATACAAAGAAGTGCAATAGGCTA 58.351 36.000 0.00 0.0 45.15 3.93
2196 2216 5.505654 CCAGTGTCGAACTATTTGCTTTGTT 60.506 40.000 0.00 0.0 36.83 2.83
2281 2301 7.300658 AGGTTGGCTTAATGGATGATCTTATT 58.699 34.615 0.00 0.0 0.00 1.40
2285 2305 8.537728 TGGCTTAATGGATGATCTTATTGTTT 57.462 30.769 0.00 0.0 0.00 2.83
2366 2386 9.979578 TTTGACATGTATCTTGCACTTATTTTT 57.020 25.926 0.00 0.0 0.00 1.94
2467 2531 5.994668 GGCAATTTTAAACATTGGGTGAAGA 59.005 36.000 17.29 0.0 32.98 2.87
2566 2631 3.596214 TGGTAAAGATTGGAAGACTCGC 58.404 45.455 0.00 0.0 0.00 5.03
2776 2841 1.261238 CCCTTGGGAGTCGCTCTCTT 61.261 60.000 8.82 0.0 42.40 2.85
2832 2902 1.464734 TCTCTAAGTGCTGGTCCGAG 58.535 55.000 0.00 0.0 0.00 4.63
2876 2946 0.955919 CGGGGAAACTTGAGGTCTGC 60.956 60.000 0.00 0.0 0.00 4.26
2903 2973 3.503363 AGTTGTACGTAGTGTTCATCCGA 59.497 43.478 0.00 0.0 45.73 4.55
2911 2981 1.164411 GTGTTCATCCGATGTTGCCA 58.836 50.000 8.24 0.0 0.00 4.92
2995 3066 5.918011 TCTTGTTTTACCATTGTCGAAATGC 59.082 36.000 12.18 0.0 0.00 3.56
3012 3083 2.296073 TGCCTTGTAAACCGGGATTT 57.704 45.000 6.32 0.0 0.00 2.17
3062 3133 3.956199 AGGAATATCCTTCGTTGACCGTA 59.044 43.478 0.00 0.0 46.91 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 2.479275 GACCTTCTGGCTAACGTTGAAC 59.521 50.000 11.99 0.85 36.63 3.18
346 347 4.514441 CCTTCTTATCTGTCCATGCATCAC 59.486 45.833 0.00 0.00 0.00 3.06
659 660 5.458452 TCTTGCACTTGAAATAGTTTTTGCG 59.542 36.000 0.00 0.00 0.00 4.85
815 816 4.134563 GCCTTGTCAACTCCTTCTTGTTA 58.865 43.478 0.00 0.00 0.00 2.41
904 905 2.802816 ACTTCAGATCACACGACTTTGC 59.197 45.455 0.00 0.00 0.00 3.68
1024 1036 7.224362 CACAACAATATGTTTCTTTGCCTCAAA 59.776 33.333 0.00 0.00 38.77 2.69
1071 1083 6.719370 TGATGTCCCAAGCAACTTTATACTTT 59.281 34.615 0.00 0.00 0.00 2.66
1077 1089 5.076182 TCAATGATGTCCCAAGCAACTTTA 58.924 37.500 0.00 0.00 0.00 1.85
1172 1184 3.727726 TCAATCTCTGACTTGTTTGCGA 58.272 40.909 0.00 0.00 0.00 5.10
1174 1186 3.251729 TGCTCAATCTCTGACTTGTTTGC 59.748 43.478 0.00 0.00 0.00 3.68
1356 1368 7.624360 TTGCTACAATAACTAACCTGGATTG 57.376 36.000 0.00 1.11 34.40 2.67
1459 1471 1.457267 TGTGCTGGTGCCATGGTTT 60.457 52.632 14.67 0.00 38.71 3.27
1678 1691 0.545171 CCCTCATCCTGTCATGCAGT 59.455 55.000 13.67 0.00 43.55 4.40
2196 2216 0.396435 ACATTGGACCGTCTCAAGCA 59.604 50.000 0.00 0.00 0.00 3.91
2467 2531 4.448720 TCCATCATGGAGCAATCTTCAT 57.551 40.909 0.66 0.00 42.67 2.57
2553 2618 2.746472 GCATAAGGGCGAGTCTTCCAAT 60.746 50.000 0.00 0.00 0.00 3.16
2554 2619 1.406887 GCATAAGGGCGAGTCTTCCAA 60.407 52.381 0.00 0.00 0.00 3.53
2566 2631 2.247358 ACAAAACACCAGGCATAAGGG 58.753 47.619 0.00 0.00 0.00 3.95
2776 2841 4.141251 GGGGCTAAATAAAGATGACCCTCA 60.141 45.833 0.00 0.00 36.31 3.86
2876 2946 7.410087 CGGATGAACACTACGTACAACTAAAAG 60.410 40.741 0.00 0.00 0.00 2.27
2911 2981 3.069300 AGCTGCACATATCTCGTTCTCAT 59.931 43.478 1.02 0.00 0.00 2.90
2995 3066 2.676342 CTCGAAATCCCGGTTTACAAGG 59.324 50.000 0.00 0.00 0.00 3.61
3012 3083 1.825474 GGAAGACCCAATCAGTCTCGA 59.175 52.381 0.00 0.00 43.77 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.