Multiple sequence alignment - TraesCS3B01G466600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G466600 chr3B 100.000 2111 0 0 1 2111 708953726 708955836 0.000000e+00 3899.0
1 TraesCS3B01G466600 chr3B 99.027 1439 10 1 677 2111 709075060 709076498 0.000000e+00 2577.0
2 TraesCS3B01G466600 chr3B 94.833 658 20 6 683 1335 709269325 709269973 0.000000e+00 1014.0
3 TraesCS3B01G466600 chr3B 94.681 658 25 4 1 658 709268566 709269213 0.000000e+00 1013.0
4 TraesCS3B01G466600 chr3B 93.205 677 21 7 1 677 709074377 709075028 0.000000e+00 972.0
5 TraesCS3B01G466600 chr3B 86.944 337 20 6 341 661 790629958 790630286 7.160000e-95 357.0
6 TraesCS3B01G466600 chr3D 86.950 1433 128 30 720 2111 536668456 536669870 0.000000e+00 1555.0
7 TraesCS3B01G466600 chr3D 86.092 1438 113 39 720 2111 536590090 536591486 0.000000e+00 1467.0
8 TraesCS3B01G466600 chr3D 86.022 1438 114 39 720 2111 536511874 536513270 0.000000e+00 1461.0
9 TraesCS3B01G466600 chr3D 86.595 1298 93 39 857 2111 536441495 536442754 0.000000e+00 1358.0
10 TraesCS3B01G466600 chr3D 86.061 1320 102 38 720 1998 536440116 536441394 0.000000e+00 1343.0
11 TraesCS3B01G466600 chr3D 90.491 652 32 9 1 642 536439067 536439698 0.000000e+00 833.0
12 TraesCS3B01G466600 chr3D 88.889 657 35 16 1 642 536879546 536880179 0.000000e+00 774.0
13 TraesCS3B01G466600 chr3D 88.235 663 34 14 1 642 536589033 536589672 0.000000e+00 752.0
14 TraesCS3B01G466600 chr3D 88.281 640 43 12 44 661 536787354 536787983 0.000000e+00 737.0
15 TraesCS3B01G466600 chr3D 87.462 662 39 14 1 642 536667387 536668024 0.000000e+00 723.0
16 TraesCS3B01G466600 chr3D 84.334 383 38 10 1734 2111 536789125 536789490 2.580000e-94 355.0
17 TraesCS3B01G466600 chrUn 86.136 1320 102 37 720 1998 359852329 359853608 0.000000e+00 1349.0
18 TraesCS3B01G466600 chrUn 90.015 681 48 13 720 1391 404927185 404926516 0.000000e+00 863.0
19 TraesCS3B01G466600 chrUn 89.868 681 49 13 720 1391 466164025 466164694 0.000000e+00 857.0
20 TraesCS3B01G466600 chrUn 89.967 299 13 3 357 642 359851617 359851911 9.200000e-99 370.0
21 TraesCS3B01G466600 chr3A 90.856 514 26 10 50 551 672088272 672088776 0.000000e+00 669.0
22 TraesCS3B01G466600 chr7B 87.834 337 17 9 341 661 500217390 500217718 7.110000e-100 374.0
23 TraesCS3B01G466600 chr5B 88.272 324 14 8 341 648 233905312 233904997 1.190000e-97 366.0
24 TraesCS3B01G466600 chr5B 100.000 28 0 0 2069 2096 424361180 424361207 4.000000e-03 52.8
25 TraesCS3B01G466600 chr6B 80.380 158 23 7 1939 2096 437842404 437842255 1.710000e-21 113.0
26 TraesCS3B01G466600 chr5A 74.161 298 50 17 1807 2093 702974400 702974119 4.790000e-17 99.0
27 TraesCS3B01G466600 chr2B 96.078 51 1 1 119 169 512626564 512626515 4.830000e-12 82.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G466600 chr3B 708953726 708955836 2110 False 3899.0 3899 100.000000 1 2111 1 chr3B.!!$F1 2110
1 TraesCS3B01G466600 chr3B 709074377 709076498 2121 False 1774.5 2577 96.116000 1 2111 2 chr3B.!!$F3 2110
2 TraesCS3B01G466600 chr3B 709268566 709269973 1407 False 1013.5 1014 94.757000 1 1335 2 chr3B.!!$F4 1334
3 TraesCS3B01G466600 chr3D 536511874 536513270 1396 False 1461.0 1461 86.022000 720 2111 1 chr3D.!!$F1 1391
4 TraesCS3B01G466600 chr3D 536439067 536442754 3687 False 1178.0 1358 87.715667 1 2111 3 chr3D.!!$F3 2110
5 TraesCS3B01G466600 chr3D 536667387 536669870 2483 False 1139.0 1555 87.206000 1 2111 2 chr3D.!!$F5 2110
6 TraesCS3B01G466600 chr3D 536589033 536591486 2453 False 1109.5 1467 87.163500 1 2111 2 chr3D.!!$F4 2110
7 TraesCS3B01G466600 chr3D 536879546 536880179 633 False 774.0 774 88.889000 1 642 1 chr3D.!!$F2 641
8 TraesCS3B01G466600 chr3D 536787354 536789490 2136 False 546.0 737 86.307500 44 2111 2 chr3D.!!$F6 2067
9 TraesCS3B01G466600 chrUn 404926516 404927185 669 True 863.0 863 90.015000 720 1391 1 chrUn.!!$R1 671
10 TraesCS3B01G466600 chrUn 359851617 359853608 1991 False 859.5 1349 88.051500 357 1998 2 chrUn.!!$F2 1641
11 TraesCS3B01G466600 chrUn 466164025 466164694 669 False 857.0 857 89.868000 720 1391 1 chrUn.!!$F1 671
12 TraesCS3B01G466600 chr3A 672088272 672088776 504 False 669.0 669 90.856000 50 551 1 chr3A.!!$F1 501

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
661 708 3.434319 GTGCGCCATGACACTGGG 61.434 66.667 4.18 0.0 36.75 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1903 3949 1.07597 TCCAGTAGAGGAGCGGCAT 60.076 57.895 1.45 0.0 32.77 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 6.734137 CACACTTACAAACATGTGTACCAAT 58.266 36.000 0.00 0.00 41.04 3.16
203 217 5.570262 TCTTTTGATACGTTCGTTCTGTG 57.430 39.130 2.62 0.00 0.00 3.66
204 218 5.045215 TCTTTTGATACGTTCGTTCTGTGT 58.955 37.500 2.62 0.00 0.00 3.72
296 310 4.591924 AGTAGTGGTAGCACAGTAGGTTTT 59.408 41.667 25.75 5.46 0.00 2.43
394 408 9.255029 ACACTTTTATCATGGGCTACTAATTTT 57.745 29.630 0.00 0.00 0.00 1.82
409 423 8.669243 GCTACTAATTTTTAGCTTGTCATGTCT 58.331 33.333 0.00 0.00 38.16 3.41
661 708 3.434319 GTGCGCCATGACACTGGG 61.434 66.667 4.18 0.00 36.75 4.45
862 1620 7.328404 TGCATATATATCCAGAGGGTCAAAA 57.672 36.000 0.00 0.00 34.93 2.44
1884 3930 0.390603 CCGAATGACAACTACCGCCA 60.391 55.000 0.00 0.00 0.00 5.69
1894 3940 0.456221 ACTACCGCCATCAGAACGAG 59.544 55.000 0.00 0.00 0.00 4.18
1897 3943 3.257561 CGCCATCAGAACGAGCCG 61.258 66.667 0.00 0.00 0.00 5.52
1901 3947 1.741401 CATCAGAACGAGCCGCCAA 60.741 57.895 0.00 0.00 0.00 4.52
1903 3949 2.449031 ATCAGAACGAGCCGCCAACA 62.449 55.000 0.00 0.00 0.00 3.33
1904 3950 2.034879 CAGAACGAGCCGCCAACAT 61.035 57.895 0.00 0.00 0.00 2.71
1951 4008 6.620089 GCATGACATTATCGATGACATTCAGG 60.620 42.308 8.54 6.50 44.84 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 6.413892 TGAATACATTGCAACATCCAGTCTA 58.586 36.000 0.00 0.00 0.00 2.59
77 78 6.435292 AAAGGGCTCAAGAAGTAGTAAGAA 57.565 37.500 0.00 0.00 0.00 2.52
130 144 7.041372 TGAGTGGTTAGCTATCTCAAAAACAAC 60.041 37.037 12.64 4.31 33.18 3.32
196 210 3.938963 TCTCACAGGAAACAACACAGAAC 59.061 43.478 0.00 0.00 0.00 3.01
202 216 3.953612 AGCATTTCTCACAGGAAACAACA 59.046 39.130 0.00 0.00 37.91 3.33
203 217 4.276926 AGAGCATTTCTCACAGGAAACAAC 59.723 41.667 0.00 0.00 44.35 3.32
204 218 4.276678 CAGAGCATTTCTCACAGGAAACAA 59.723 41.667 0.00 0.00 44.35 2.83
296 310 5.721480 TCTTACATCCTGATTCACTTCCTGA 59.279 40.000 0.00 0.00 0.00 3.86
394 408 3.324846 ACAGGACAGACATGACAAGCTAA 59.675 43.478 0.00 0.00 34.19 3.09
409 423 2.694628 AGAAATTGCTGCAAACAGGACA 59.305 40.909 20.06 0.00 44.82 4.02
661 708 0.108585 TGGCAAGTCCTTCCTGTGAC 59.891 55.000 0.00 0.00 35.26 3.67
862 1620 7.609918 GCACCCCAACCAAATCTTAAATTAAAT 59.390 33.333 0.00 0.00 0.00 1.40
1884 3930 1.741770 GTTGGCGGCTCGTTCTGAT 60.742 57.895 11.43 0.00 0.00 2.90
1897 3943 2.593468 TAGAGGAGCGGCATGTTGGC 62.593 60.000 1.45 0.00 39.85 4.52
1901 3947 1.680522 CCAGTAGAGGAGCGGCATGT 61.681 60.000 1.45 0.00 0.00 3.21
1903 3949 1.075970 TCCAGTAGAGGAGCGGCAT 60.076 57.895 1.45 0.00 32.77 4.40
1904 3950 2.359011 TCCAGTAGAGGAGCGGCA 59.641 61.111 1.45 0.00 32.77 5.69
1951 4008 1.464997 GGGAACGTGCATGAAGACTTC 59.535 52.381 14.17 8.34 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.