Multiple sequence alignment - TraesCS3B01G463500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G463500 chr3B 100.000 2499 0 0 1 2499 706346105 706348603 0 4615
1 TraesCS3B01G463500 chr3B 98.559 2499 34 2 1 2499 193971336 193968840 0 4414
2 TraesCS3B01G463500 chr3B 98.240 2500 40 4 1 2499 542908506 542906010 0 4370
3 TraesCS3B01G463500 chr3A 98.362 2503 35 6 1 2499 212711040 212713540 0 4390
4 TraesCS3B01G463500 chr3A 98.241 2501 39 5 1 2499 591384378 591381881 0 4370
5 TraesCS3B01G463500 chr7A 98.321 2502 37 5 1 2499 393650426 393647927 0 4383
6 TraesCS3B01G463500 chr1A 98.319 2499 39 3 1 2499 521311190 521313685 0 4379
7 TraesCS3B01G463500 chr1A 98.243 2504 37 7 1 2499 531039277 531041778 0 4373
8 TraesCS3B01G463500 chr5A 98.202 2503 39 5 1 2499 687724736 687722236 0 4368
9 TraesCS3B01G463500 chr1B 98.201 2502 40 4 1 2499 419959910 419962409 0 4366


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G463500 chr3B 706346105 706348603 2498 False 4615 4615 100.000 1 2499 1 chr3B.!!$F1 2498
1 TraesCS3B01G463500 chr3B 193968840 193971336 2496 True 4414 4414 98.559 1 2499 1 chr3B.!!$R1 2498
2 TraesCS3B01G463500 chr3B 542906010 542908506 2496 True 4370 4370 98.240 1 2499 1 chr3B.!!$R2 2498
3 TraesCS3B01G463500 chr3A 212711040 212713540 2500 False 4390 4390 98.362 1 2499 1 chr3A.!!$F1 2498
4 TraesCS3B01G463500 chr3A 591381881 591384378 2497 True 4370 4370 98.241 1 2499 1 chr3A.!!$R1 2498
5 TraesCS3B01G463500 chr7A 393647927 393650426 2499 True 4383 4383 98.321 1 2499 1 chr7A.!!$R1 2498
6 TraesCS3B01G463500 chr1A 521311190 521313685 2495 False 4379 4379 98.319 1 2499 1 chr1A.!!$F1 2498
7 TraesCS3B01G463500 chr1A 531039277 531041778 2501 False 4373 4373 98.243 1 2499 1 chr1A.!!$F2 2498
8 TraesCS3B01G463500 chr5A 687722236 687724736 2500 True 4368 4368 98.202 1 2499 1 chr5A.!!$R1 2498
9 TraesCS3B01G463500 chr1B 419959910 419962409 2499 False 4366 4366 98.201 1 2499 1 chr1B.!!$F1 2498

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
169 170 0.984995 GGCCACTAAGGAACAGACCT 59.015 55.000 0.00 0.00 41.22 3.85 F
1102 1111 1.203994 AGAACCAACGTATCGAGGTGG 59.796 52.381 5.71 5.71 38.32 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1404 1414 0.531974 GTGAAAGCCACAGTCCGTCA 60.532 55.000 0.0 0.0 45.03 4.35 R
1939 1953 6.071560 ACGATGACTTTCACTAACCATGTCTA 60.072 38.462 0.0 0.0 0.00 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 124 3.084191 GGTAGTTCACCCACCTCCT 57.916 57.895 0.00 0.00 42.07 3.69
169 170 0.984995 GGCCACTAAGGAACAGACCT 59.015 55.000 0.00 0.00 41.22 3.85
396 400 9.725019 TTCTTCCATGCTATATCGTTTTCATAT 57.275 29.630 0.00 0.00 0.00 1.78
663 667 2.288213 CGGTGACTTCAAGCTCACACTA 60.288 50.000 16.88 0.00 38.89 2.74
692 696 6.875972 ATATGTGAGTACTCCTTTCCTGTT 57.124 37.500 20.11 0.00 0.00 3.16
982 991 8.777413 TGTGAACTTTGTATCTCATTTCTTCAG 58.223 33.333 0.00 0.00 0.00 3.02
1102 1111 1.203994 AGAACCAACGTATCGAGGTGG 59.796 52.381 5.71 5.71 38.32 4.61
1281 1290 7.372714 GGAACACATAATTTCTTTTAACCCGT 58.627 34.615 0.00 0.00 0.00 5.28
1316 1325 4.469227 CCATTTTTACATCAATCCACCCCA 59.531 41.667 0.00 0.00 0.00 4.96
1381 1391 2.607771 GCTGTCCATTTTGCGTGTTCAT 60.608 45.455 0.00 0.00 0.00 2.57
1404 1414 3.476552 TGAACTCTTTTTCCTCGTGCAT 58.523 40.909 0.00 0.00 0.00 3.96
1506 1516 4.929808 GGTCGTTGAGCTCTGAAAAATCTA 59.070 41.667 16.19 0.00 0.00 1.98
1616 1626 1.343142 AGTACAAGTGATCACGTGGCA 59.657 47.619 34.69 23.63 43.49 4.92
2475 2495 5.361427 TGGCAAATGCATTTATCCATTCAG 58.639 37.500 27.89 15.02 44.36 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 124 2.707849 GGGCTCGTAGTCTTCCGCA 61.708 63.158 0.00 0.00 0.00 5.69
248 249 6.296087 GCAAGATGAGAGATTATGGGGTATGA 60.296 42.308 0.00 0.00 0.00 2.15
396 400 3.006430 TCGTTCTGTCCAAACATGAGCTA 59.994 43.478 0.00 0.00 34.13 3.32
663 667 8.606830 AGGAAAGGAGTACTCACATATTTCTTT 58.393 33.333 23.91 18.81 0.00 2.52
1102 1111 3.727970 GCTTCCGAACGGATTGAATCAAC 60.728 47.826 16.57 0.00 44.74 3.18
1316 1325 7.067372 TCAGTTCAGATGTGTCAACAAAAAGAT 59.933 33.333 0.00 0.00 40.46 2.40
1381 1391 3.131396 GCACGAGGAAAAAGAGTTCAGA 58.869 45.455 0.00 0.00 0.00 3.27
1404 1414 0.531974 GTGAAAGCCACAGTCCGTCA 60.532 55.000 0.00 0.00 45.03 4.35
1496 1506 5.048083 GCCAGTTCCATGTGTAGATTTTTCA 60.048 40.000 0.00 0.00 0.00 2.69
1506 1516 0.603707 CGTCAGCCAGTTCCATGTGT 60.604 55.000 0.00 0.00 0.00 3.72
1616 1626 1.508632 GTGTGCGTCTGGTGTGTAAT 58.491 50.000 0.00 0.00 0.00 1.89
1919 1933 9.632638 ATGTCTATTAAACTACATTTGCCATCT 57.367 29.630 0.00 0.00 0.00 2.90
1936 1950 9.817809 GATGACTTTCACTAACCATGTCTATTA 57.182 33.333 0.00 0.00 0.00 0.98
1939 1953 6.071560 ACGATGACTTTCACTAACCATGTCTA 60.072 38.462 0.00 0.00 0.00 2.59
2420 2439 7.147461 TGGGTACTTAATCTGCCATGTTATGTA 60.147 37.037 0.00 0.00 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.