Multiple sequence alignment - TraesCS3B01G446100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G446100 chr3B 100.000 3044 0 0 1 3044 685640848 685637805 0.000000e+00 5622.0
1 TraesCS3B01G446100 chr3B 99.215 3056 10 7 1 3044 685669351 685666298 0.000000e+00 5498.0
2 TraesCS3B01G446100 chr3B 89.515 887 70 10 895 1777 658462576 658463443 0.000000e+00 1101.0
3 TraesCS3B01G446100 chr3B 80.178 338 47 15 1756 2083 658463485 658463812 5.070000e-58 235.0
4 TraesCS3B01G446100 chr3B 81.949 277 32 12 2351 2624 658464118 658464379 5.110000e-53 219.0
5 TraesCS3B01G446100 chr3B 93.651 63 3 1 2292 2354 685638514 685638453 3.230000e-15 93.5
6 TraesCS3B01G446100 chr3B 93.651 63 3 1 2292 2354 685667007 685666946 3.230000e-15 93.5
7 TraesCS3B01G446100 chr3B 95.918 49 2 0 2003 2051 601379839 601379791 2.520000e-11 80.5
8 TraesCS3B01G446100 chr3A 92.152 1784 82 27 660 2428 655926660 655924920 0.000000e+00 2466.0
9 TraesCS3B01G446100 chr3A 93.212 1650 73 12 813 2441 658195159 658196790 0.000000e+00 2390.0
10 TraesCS3B01G446100 chr3A 88.262 886 81 14 895 1777 636572348 636571483 0.000000e+00 1038.0
11 TraesCS3B01G446100 chr3A 90.066 604 35 7 2357 2956 658196838 658197420 0.000000e+00 760.0
12 TraesCS3B01G446100 chr3A 92.439 529 33 3 46 572 655931526 655931003 0.000000e+00 749.0
13 TraesCS3B01G446100 chr3A 92.060 529 35 3 46 572 658191982 658192505 0.000000e+00 737.0
14 TraesCS3B01G446100 chr3A 91.892 407 23 3 2357 2761 655924854 655924456 7.370000e-156 560.0
15 TraesCS3B01G446100 chr3A 78.475 446 32 26 572 999 658192812 658193211 1.820000e-57 233.0
16 TraesCS3B01G446100 chr3A 83.408 223 29 5 1868 2083 636566019 636565798 1.850000e-47 200.0
17 TraesCS3B01G446100 chr3A 78.453 362 31 22 572 925 655930696 655930374 3.100000e-45 193.0
18 TraesCS3B01G446100 chr3A 98.113 106 2 0 2337 2442 658196752 658196857 5.180000e-43 185.0
19 TraesCS3B01G446100 chr3A 96.226 106 4 0 2337 2442 655924940 655924835 1.120000e-39 174.0
20 TraesCS3B01G446100 chr3A 95.238 63 2 1 2292 2354 655925013 655924952 6.950000e-17 99.0
21 TraesCS3B01G446100 chr3A 95.238 63 2 1 2292 2354 658196679 658196740 6.950000e-17 99.0
22 TraesCS3B01G446100 chr3A 98.000 50 1 0 1 50 658191081 658191130 1.500000e-13 87.9
23 TraesCS3B01G446100 chr3D 94.194 1533 71 9 766 2296 520610434 520608918 0.000000e+00 2322.0
24 TraesCS3B01G446100 chr3D 86.952 889 86 17 895 1777 497859142 497860006 0.000000e+00 972.0
25 TraesCS3B01G446100 chr3D 90.369 623 24 6 2337 2957 520608687 520608099 0.000000e+00 785.0
26 TraesCS3B01G446100 chr3D 79.640 555 61 36 2357 2881 497860692 497861224 4.830000e-93 351.0
27 TraesCS3B01G446100 chr3D 97.638 127 3 0 2315 2441 520608780 520608654 5.110000e-53 219.0
28 TraesCS3B01G446100 chr3D 97.674 43 1 0 2292 2334 520608760 520608718 1.170000e-09 75.0
29 TraesCS3B01G446100 chr6B 77.671 627 75 46 2357 2957 718808334 718808921 3.790000e-84 322.0
30 TraesCS3B01G446100 chr1B 77.033 627 79 47 2357 2957 56051359 56050772 1.770000e-77 300.0
31 TraesCS3B01G446100 chr2B 77.455 550 75 37 2357 2881 123553926 123554451 1.790000e-72 283.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G446100 chr3B 685637805 685640848 3043 True 2857.750000 5622 96.825500 1 3044 2 chr3B.!!$R2 3043
1 TraesCS3B01G446100 chr3B 685666298 685669351 3053 True 2795.750000 5498 96.433000 1 3044 2 chr3B.!!$R3 3043
2 TraesCS3B01G446100 chr3B 658462576 658464379 1803 False 518.333333 1101 83.880667 895 2624 3 chr3B.!!$F1 1729
3 TraesCS3B01G446100 chr3A 636571483 636572348 865 True 1038.000000 1038 88.262000 895 1777 1 chr3A.!!$R2 882
4 TraesCS3B01G446100 chr3A 655924456 655926660 2204 True 824.750000 2466 93.877000 660 2761 4 chr3A.!!$R3 2101
5 TraesCS3B01G446100 chr3A 658191081 658197420 6339 False 641.700000 2390 92.166286 1 2956 7 chr3A.!!$F1 2955
6 TraesCS3B01G446100 chr3A 655930374 655931526 1152 True 471.000000 749 85.446000 46 925 2 chr3A.!!$R4 879
7 TraesCS3B01G446100 chr3D 520608099 520610434 2335 True 850.250000 2322 94.968750 766 2957 4 chr3D.!!$R1 2191
8 TraesCS3B01G446100 chr3D 497859142 497861224 2082 False 661.500000 972 83.296000 895 2881 2 chr3D.!!$F1 1986
9 TraesCS3B01G446100 chr6B 718808334 718808921 587 False 322.000000 322 77.671000 2357 2957 1 chr6B.!!$F1 600
10 TraesCS3B01G446100 chr1B 56050772 56051359 587 True 300.000000 300 77.033000 2357 2957 1 chr1B.!!$R1 600
11 TraesCS3B01G446100 chr2B 123553926 123554451 525 False 283.000000 283 77.455000 2357 2881 1 chr2B.!!$F1 524

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
160 1018 0.692476 TGAGTGATCACTTGGTGGGG 59.308 55.0 28.46 0.0 42.66 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2287 5743 6.716628 TCAAACTTAAGAATCACATTGCTCCT 59.283 34.615 10.09 0.0 0.0 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 1018 0.692476 TGAGTGATCACTTGGTGGGG 59.308 55.000 28.46 0.0 42.66 4.96
1670 5035 3.250323 CAGCGTCGATCAGCACGG 61.250 66.667 11.90 0.0 36.50 4.94
2287 5743 9.797642 ATGACAATATATCATGGCTCAGTTTTA 57.202 29.630 0.00 0.0 35.44 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
354 1212 2.417651 CCATGTTTTCCGCAATGAGCAT 60.418 45.455 0.00 0.0 46.13 3.79
2287 5743 6.716628 TCAAACTTAAGAATCACATTGCTCCT 59.283 34.615 10.09 0.0 0.00 3.69
2885 6712 9.525409 ACGGAGTATATGTTATGTTGAAGTAAC 57.475 33.333 0.00 0.0 41.94 2.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.