Multiple sequence alignment - TraesCS3B01G412200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G412200 chr3B 100.000 2846 0 0 1 2846 648598772 648601617 0 5256
1 TraesCS3B01G412200 chr3B 94.878 2870 112 8 3 2846 539813343 539816203 0 4453
2 TraesCS3B01G412200 chr3B 94.708 2872 116 7 1 2846 26734431 26731570 0 4429
3 TraesCS3B01G412200 chr3B 94.292 2873 129 18 1 2846 29041210 29044074 0 4364
4 TraesCS3B01G412200 chr3B 93.593 2872 147 10 1 2846 322649562 322652422 0 4250
5 TraesCS3B01G412200 chr7B 95.737 2862 97 2 10 2846 402066353 402063492 0 4586
6 TraesCS3B01G412200 chr7B 95.507 2871 98 4 1 2846 400981732 400978868 0 4558
7 TraesCS3B01G412200 chr1B 95.507 2871 95 13 1 2846 664230548 664233409 0 4556
8 TraesCS3B01G412200 chr1B 94.880 2871 114 13 1 2846 388072192 388069330 0 4457
9 TraesCS3B01G412200 chr1B 94.288 2871 127 8 1 2846 614464227 614467085 0 4359
10 TraesCS3B01G412200 chr1B 93.837 2872 142 6 1 2846 553848637 553845775 0 4290
11 TraesCS3B01G412200 chr1B 95.266 2683 96 10 189 2846 83279395 83276719 0 4222
12 TraesCS3B01G412200 chr6B 94.969 2862 110 11 10 2846 553704551 553701699 0 4457
13 TraesCS3B01G412200 chr6B 94.464 2872 123 7 1 2846 145720947 145718086 0 4390
14 TraesCS3B01G412200 chr6B 93.521 2871 150 17 1 2846 217694663 217691804 0 4239
15 TraesCS3B01G412200 chr5B 94.779 2873 119 7 1 2846 692171428 692174296 0 4446
16 TraesCS3B01G412200 chr5B 93.700 2873 146 15 1 2846 555868832 555865968 0 4270
17 TraesCS3B01G412200 chr2B 94.599 2870 117 7 3 2846 43717083 43714226 0 4407


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G412200 chr3B 648598772 648601617 2845 False 5256 5256 100.000 1 2846 1 chr3B.!!$F4 2845
1 TraesCS3B01G412200 chr3B 539813343 539816203 2860 False 4453 4453 94.878 3 2846 1 chr3B.!!$F3 2843
2 TraesCS3B01G412200 chr3B 26731570 26734431 2861 True 4429 4429 94.708 1 2846 1 chr3B.!!$R1 2845
3 TraesCS3B01G412200 chr3B 29041210 29044074 2864 False 4364 4364 94.292 1 2846 1 chr3B.!!$F1 2845
4 TraesCS3B01G412200 chr3B 322649562 322652422 2860 False 4250 4250 93.593 1 2846 1 chr3B.!!$F2 2845
5 TraesCS3B01G412200 chr7B 402063492 402066353 2861 True 4586 4586 95.737 10 2846 1 chr7B.!!$R2 2836
6 TraesCS3B01G412200 chr7B 400978868 400981732 2864 True 4558 4558 95.507 1 2846 1 chr7B.!!$R1 2845
7 TraesCS3B01G412200 chr1B 664230548 664233409 2861 False 4556 4556 95.507 1 2846 1 chr1B.!!$F2 2845
8 TraesCS3B01G412200 chr1B 388069330 388072192 2862 True 4457 4457 94.880 1 2846 1 chr1B.!!$R2 2845
9 TraesCS3B01G412200 chr1B 614464227 614467085 2858 False 4359 4359 94.288 1 2846 1 chr1B.!!$F1 2845
10 TraesCS3B01G412200 chr1B 553845775 553848637 2862 True 4290 4290 93.837 1 2846 1 chr1B.!!$R3 2845
11 TraesCS3B01G412200 chr1B 83276719 83279395 2676 True 4222 4222 95.266 189 2846 1 chr1B.!!$R1 2657
12 TraesCS3B01G412200 chr6B 553701699 553704551 2852 True 4457 4457 94.969 10 2846 1 chr6B.!!$R3 2836
13 TraesCS3B01G412200 chr6B 145718086 145720947 2861 True 4390 4390 94.464 1 2846 1 chr6B.!!$R1 2845
14 TraesCS3B01G412200 chr6B 217691804 217694663 2859 True 4239 4239 93.521 1 2846 1 chr6B.!!$R2 2845
15 TraesCS3B01G412200 chr5B 692171428 692174296 2868 False 4446 4446 94.779 1 2846 1 chr5B.!!$F1 2845
16 TraesCS3B01G412200 chr5B 555865968 555868832 2864 True 4270 4270 93.700 1 2846 1 chr5B.!!$R1 2845
17 TraesCS3B01G412200 chr2B 43714226 43717083 2857 True 4407 4407 94.599 3 2846 1 chr2B.!!$R1 2843

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
606 610 2.151202 GCGGTGATTCAGAAGGTTCAA 58.849 47.619 0.0 0.0 0.00 2.69 F
1047 1066 3.706373 GCGACCCTGAAGGAGGCA 61.706 66.667 0.0 0.0 41.19 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1494 1514 1.291588 CTCGACCAGCTGCTTCAGT 59.708 57.895 8.66 0.0 33.43 3.41 R
2762 2811 0.669625 ACGGAGAAAGGCTACAACGC 60.670 55.000 0.00 0.0 0.00 4.84 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
494 498 4.681978 GGGCAAGACCGTGACGCT 62.682 66.667 0.00 0.00 40.62 5.07
550 554 3.982316 CTGGAGGCGCTCAATGGCA 62.982 63.158 7.64 0.00 31.08 4.92
606 610 2.151202 GCGGTGATTCAGAAGGTTCAA 58.849 47.619 0.00 0.00 0.00 2.69
1047 1066 3.706373 GCGACCCTGAAGGAGGCA 61.706 66.667 0.00 0.00 41.19 4.75
1494 1514 2.349755 GTGCCCCTTAGCGACCAA 59.650 61.111 0.00 0.00 34.65 3.67
1593 1613 0.257039 CCATGCCTGGGAGCTACTTT 59.743 55.000 0.00 0.00 39.04 2.66
1892 1912 6.489675 CGCTGAAAACTTAGTTCATATGCAT 58.510 36.000 3.79 3.79 34.59 3.96
2238 2259 2.504175 AGCGGCATAAGTCTTTAGGGAA 59.496 45.455 1.45 0.00 0.00 3.97
2331 2353 2.579201 GCTCGCCCAGCTCAACTA 59.421 61.111 0.00 0.00 45.83 2.24
2754 2803 1.557099 TGCTCGTAATGGAGACCACT 58.443 50.000 0.00 0.00 35.80 4.00
2762 2811 4.991056 CGTAATGGAGACCACTTGGATATG 59.009 45.833 1.14 0.00 35.80 1.78
2780 2829 0.669318 TGCGTTGTAGCCTTTCTCCG 60.669 55.000 0.00 0.00 36.02 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 51 1.827792 TTCCCTTCTTGGACCCTTCA 58.172 50.000 0.00 0.0 38.35 3.02
145 147 3.819902 GGAGTCCGGATACTTACGATCTT 59.180 47.826 7.81 0.0 0.00 2.40
331 335 1.841556 GGGATCCCACCTCGGCATA 60.842 63.158 26.95 0.0 35.81 3.14
494 498 4.329545 GTTGGACGGAGGCTGCCA 62.330 66.667 22.65 0.0 0.00 4.92
520 524 0.178068 GCCTCCAGCAAGTTATCCGA 59.822 55.000 0.00 0.0 42.97 4.55
559 563 0.532862 ACAGTGCGGTGTTCCTCTTG 60.533 55.000 0.00 0.0 0.00 3.02
1494 1514 1.291588 CTCGACCAGCTGCTTCAGT 59.708 57.895 8.66 0.0 33.43 3.41
2067 2088 2.032680 TATAAGTCCGGTTGCCTTGC 57.967 50.000 0.00 0.0 0.00 4.01
2371 2393 4.021544 TGGTACCTTACGTTCCGTTGTATT 60.022 41.667 14.36 0.0 41.54 1.89
2754 2803 3.275617 AAGGCTACAACGCATATCCAA 57.724 42.857 0.00 0.0 0.00 3.53
2762 2811 0.669625 ACGGAGAAAGGCTACAACGC 60.670 55.000 0.00 0.0 0.00 4.84
2780 2829 0.682209 ATGATGCAACAGCCAGGGAC 60.682 55.000 2.25 0.0 0.00 4.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.