Multiple sequence alignment - TraesCS3B01G411800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G411800 chr3B 100.000 2291 0 0 1 2291 647970325 647968035 0.000000e+00 4231
1 TraesCS3B01G411800 chr3B 99.646 1129 3 1 366 1494 647944553 647943426 0.000000e+00 2061
2 TraesCS3B01G411800 chr3B 97.365 797 19 1 1495 2291 647963338 647962544 0.000000e+00 1354
3 TraesCS3B01G411800 chr3B 91.974 461 23 14 1494 1947 29949116 29948663 3.210000e-178 634
4 TraesCS3B01G411800 chr3A 91.050 1229 66 12 274 1494 628220919 628219727 0.000000e+00 1620
5 TraesCS3B01G411800 chr3A 93.031 287 14 4 1 283 628226719 628226435 4.550000e-112 414
6 TraesCS3B01G411800 chrUn 99.317 879 6 0 1 879 250504867 250505745 0.000000e+00 1591
7 TraesCS3B01G411800 chrUn 95.896 804 25 6 1495 2291 15956509 15957311 0.000000e+00 1295
8 TraesCS3B01G411800 chrUn 92.286 713 42 9 1495 2202 346457491 346456787 0.000000e+00 1000
9 TraesCS3B01G411800 chrUn 92.286 713 42 9 1495 2202 347364763 347365467 0.000000e+00 1000
10 TraesCS3B01G411800 chr3D 89.616 1146 61 23 373 1494 485233049 485231938 0.000000e+00 1404
11 TraesCS3B01G411800 chr3D 94.697 264 9 4 102 363 485233290 485233030 2.740000e-109 405
12 TraesCS3B01G411800 chr2B 94.379 765 37 6 1495 2257 679820030 679820790 0.000000e+00 1170
13 TraesCS3B01G411800 chr1B 92.228 772 46 13 1495 2257 651301370 651300604 0.000000e+00 1081
14 TraesCS3B01G411800 chr1B 78.916 1162 132 64 406 1494 584574455 584575576 0.000000e+00 684
15 TraesCS3B01G411800 chr1B 78.916 1162 132 64 406 1494 584619816 584620937 0.000000e+00 684
16 TraesCS3B01G411800 chr1B 81.808 863 85 37 670 1494 584603477 584604305 0.000000e+00 658
17 TraesCS3B01G411800 chr1B 81.576 863 87 37 670 1494 584653911 584654739 0.000000e+00 647
18 TraesCS3B01G411800 chr1B 86.332 578 58 17 1495 2060 107128218 107127650 5.410000e-171 610
19 TraesCS3B01G411800 chr5A 83.353 835 87 41 1493 2291 605355831 605356649 0.000000e+00 725
20 TraesCS3B01G411800 chr5A 84.347 773 81 33 1549 2291 552474871 552474109 0.000000e+00 721
21 TraesCS3B01G411800 chr1D 87.057 649 50 20 873 1494 433060434 433061075 0.000000e+00 702
22 TraesCS3B01G411800 chr1D 87.956 548 41 16 967 1494 433092598 433093140 6.950000e-175 623
23 TraesCS3B01G411800 chr6B 87.762 572 53 12 1495 2056 689185772 689186336 0.000000e+00 652
24 TraesCS3B01G411800 chr1A 84.544 647 66 20 873 1494 531366891 531367528 5.410000e-171 610
25 TraesCS3B01G411800 chr2A 95.625 160 5 1 2132 2291 715783792 715783949 2.920000e-64 255


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G411800 chr3B 647968035 647970325 2290 True 4231.0 4231 100.0000 1 2291 1 chr3B.!!$R4 2290
1 TraesCS3B01G411800 chr3B 647943426 647944553 1127 True 2061.0 2061 99.6460 366 1494 1 chr3B.!!$R2 1128
2 TraesCS3B01G411800 chr3B 647962544 647963338 794 True 1354.0 1354 97.3650 1495 2291 1 chr3B.!!$R3 796
3 TraesCS3B01G411800 chr3A 628219727 628220919 1192 True 1620.0 1620 91.0500 274 1494 1 chr3A.!!$R1 1220
4 TraesCS3B01G411800 chrUn 250504867 250505745 878 False 1591.0 1591 99.3170 1 879 1 chrUn.!!$F2 878
5 TraesCS3B01G411800 chrUn 15956509 15957311 802 False 1295.0 1295 95.8960 1495 2291 1 chrUn.!!$F1 796
6 TraesCS3B01G411800 chrUn 346456787 346457491 704 True 1000.0 1000 92.2860 1495 2202 1 chrUn.!!$R1 707
7 TraesCS3B01G411800 chrUn 347364763 347365467 704 False 1000.0 1000 92.2860 1495 2202 1 chrUn.!!$F3 707
8 TraesCS3B01G411800 chr3D 485231938 485233290 1352 True 904.5 1404 92.1565 102 1494 2 chr3D.!!$R1 1392
9 TraesCS3B01G411800 chr2B 679820030 679820790 760 False 1170.0 1170 94.3790 1495 2257 1 chr2B.!!$F1 762
10 TraesCS3B01G411800 chr1B 651300604 651301370 766 True 1081.0 1081 92.2280 1495 2257 1 chr1B.!!$R2 762
11 TraesCS3B01G411800 chr1B 584574455 584575576 1121 False 684.0 684 78.9160 406 1494 1 chr1B.!!$F1 1088
12 TraesCS3B01G411800 chr1B 584619816 584620937 1121 False 684.0 684 78.9160 406 1494 1 chr1B.!!$F3 1088
13 TraesCS3B01G411800 chr1B 584603477 584604305 828 False 658.0 658 81.8080 670 1494 1 chr1B.!!$F2 824
14 TraesCS3B01G411800 chr1B 584653911 584654739 828 False 647.0 647 81.5760 670 1494 1 chr1B.!!$F4 824
15 TraesCS3B01G411800 chr1B 107127650 107128218 568 True 610.0 610 86.3320 1495 2060 1 chr1B.!!$R1 565
16 TraesCS3B01G411800 chr5A 605355831 605356649 818 False 725.0 725 83.3530 1493 2291 1 chr5A.!!$F1 798
17 TraesCS3B01G411800 chr5A 552474109 552474871 762 True 721.0 721 84.3470 1549 2291 1 chr5A.!!$R1 742
18 TraesCS3B01G411800 chr1D 433060434 433061075 641 False 702.0 702 87.0570 873 1494 1 chr1D.!!$F1 621
19 TraesCS3B01G411800 chr1D 433092598 433093140 542 False 623.0 623 87.9560 967 1494 1 chr1D.!!$F2 527
20 TraesCS3B01G411800 chr6B 689185772 689186336 564 False 652.0 652 87.7620 1495 2056 1 chr6B.!!$F1 561
21 TraesCS3B01G411800 chr1A 531366891 531367528 637 False 610.0 610 84.5440 873 1494 1 chr1A.!!$F1 621

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
39 40 0.461339 GCCTCAAAATGCATGCCCTG 60.461 55.0 16.68 7.14 0.0 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1627 1773 1.371337 CCTCGTGATACGTGACCCGA 61.371 60.0 0.0 0.0 43.14 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 0.461339 GCCTCAAAATGCATGCCCTG 60.461 55.000 16.68 7.14 0.00 4.45
180 181 4.145876 CGCAAGCATGAGTTCTTTTGTA 57.854 40.909 0.00 0.00 0.00 2.41
363 375 9.013490 GCATGCATGTATATTTATTCGAATTCC 57.987 33.333 26.79 0.46 0.00 3.01
879 949 5.146010 TCAAAATTCAAATGCCCACCTAC 57.854 39.130 0.00 0.00 0.00 3.18
1339 1483 0.614697 TGATGCTTCCGTCCTCCTCA 60.615 55.000 0.00 0.00 0.00 3.86
1488 1632 1.154016 CAGACATCGTCGCCTTCGT 60.154 57.895 0.00 0.00 37.67 3.85
1627 1773 3.684413 CGCAATATAAAGAGGTGGGGTGT 60.684 47.826 0.00 0.00 0.00 4.16
1632 1778 3.786866 AAGAGGTGGGGTGTCGGGT 62.787 63.158 0.00 0.00 0.00 5.28
1892 2065 7.941795 TTTCGGTACAAAGAAACAAAAACAA 57.058 28.000 0.00 0.00 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 6.150809 GGAGGATGGCTATGAATCTTGAAATC 59.849 42.308 0.00 0.0 0.00 2.17
1339 1483 2.995574 CTGAACGGGGTCGGGTCT 60.996 66.667 0.00 0.0 41.39 3.85
1488 1632 1.559682 GAGATCAACCTAACAGGGCCA 59.440 52.381 6.18 0.0 40.58 5.36
1565 1711 2.206536 CCATGGTTTGGTTGGGCGT 61.207 57.895 2.57 0.0 40.99 5.68
1627 1773 1.371337 CCTCGTGATACGTGACCCGA 61.371 60.000 0.00 0.0 43.14 5.14
1632 1778 2.223180 CGATCAACCTCGTGATACGTGA 60.223 50.000 0.00 0.8 43.14 4.35
2108 2291 1.683441 CGGTGCTAACCCCCTTCTT 59.317 57.895 0.00 0.0 44.42 2.52
2109 2292 2.967946 GCGGTGCTAACCCCCTTCT 61.968 63.158 0.00 0.0 44.42 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.