Multiple sequence alignment - TraesCS3B01G381700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G381700 chr3B 100.000 2438 0 0 1 2438 600724395 600721958 0 4503
1 TraesCS3B01G381700 chr3B 95.263 2449 97 8 4 2438 600811011 600808568 0 3862
2 TraesCS3B01G381700 chr3B 94.120 2449 122 10 4 2438 600686155 600683715 0 3705
3 TraesCS3B01G381700 chr3B 89.202 2445 230 18 10 2438 136864985 136862559 0 3022
4 TraesCS3B01G381700 chr3B 91.098 2112 158 15 352 2438 543790839 543788733 0 2832
5 TraesCS3B01G381700 chr3B 89.251 1442 128 15 1012 2438 119553431 119552002 0 1779
6 TraesCS3B01G381700 chr7B 89.833 2449 215 15 15 2437 600951683 600949243 0 3112
7 TraesCS3B01G381700 chr6B 89.743 2447 219 15 15 2436 590255078 590252639 0 3099
8 TraesCS3B01G381700 chr6B 88.979 2459 238 15 6 2438 122918168 122920619 0 3009
9 TraesCS3B01G381700 chr6B 88.336 2452 252 21 5 2438 190437241 190439676 0 2913
10 TraesCS3B01G381700 chr6B 89.395 2131 203 11 1 2116 169614690 169616812 0 2662
11 TraesCS3B01G381700 chr2B 89.678 2451 217 19 15 2438 170716046 170713605 0 3092
12 TraesCS3B01G381700 chr2B 88.780 2451 238 22 5 2438 246192273 246189843 0 2968
13 TraesCS3B01G381700 chr2B 92.457 875 51 5 1578 2438 696571205 696572078 0 1236
14 TraesCS3B01G381700 chr5B 89.510 2450 222 21 5 2438 430441439 430443869 0 3068
15 TraesCS3B01G381700 chr4B 88.610 2432 242 25 4 2417 155993890 155991476 0 2924
16 TraesCS3B01G381700 chr4B 87.796 2450 261 25 4 2438 377199850 377197424 0 2833
17 TraesCS3B01G381700 chr4B 86.765 2448 283 24 11 2438 339692376 339689950 0 2687
18 TraesCS3B01G381700 chr1B 81.714 2450 403 34 4 2438 685068101 685070520 0 2001


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G381700 chr3B 600721958 600724395 2437 True 4503 4503 100.000 1 2438 1 chr3B.!!$R5 2437
1 TraesCS3B01G381700 chr3B 600808568 600811011 2443 True 3862 3862 95.263 4 2438 1 chr3B.!!$R6 2434
2 TraesCS3B01G381700 chr3B 600683715 600686155 2440 True 3705 3705 94.120 4 2438 1 chr3B.!!$R4 2434
3 TraesCS3B01G381700 chr3B 136862559 136864985 2426 True 3022 3022 89.202 10 2438 1 chr3B.!!$R2 2428
4 TraesCS3B01G381700 chr3B 543788733 543790839 2106 True 2832 2832 91.098 352 2438 1 chr3B.!!$R3 2086
5 TraesCS3B01G381700 chr3B 119552002 119553431 1429 True 1779 1779 89.251 1012 2438 1 chr3B.!!$R1 1426
6 TraesCS3B01G381700 chr7B 600949243 600951683 2440 True 3112 3112 89.833 15 2437 1 chr7B.!!$R1 2422
7 TraesCS3B01G381700 chr6B 590252639 590255078 2439 True 3099 3099 89.743 15 2436 1 chr6B.!!$R1 2421
8 TraesCS3B01G381700 chr6B 122918168 122920619 2451 False 3009 3009 88.979 6 2438 1 chr6B.!!$F1 2432
9 TraesCS3B01G381700 chr6B 190437241 190439676 2435 False 2913 2913 88.336 5 2438 1 chr6B.!!$F3 2433
10 TraesCS3B01G381700 chr6B 169614690 169616812 2122 False 2662 2662 89.395 1 2116 1 chr6B.!!$F2 2115
11 TraesCS3B01G381700 chr2B 170713605 170716046 2441 True 3092 3092 89.678 15 2438 1 chr2B.!!$R1 2423
12 TraesCS3B01G381700 chr2B 246189843 246192273 2430 True 2968 2968 88.780 5 2438 1 chr2B.!!$R2 2433
13 TraesCS3B01G381700 chr2B 696571205 696572078 873 False 1236 1236 92.457 1578 2438 1 chr2B.!!$F1 860
14 TraesCS3B01G381700 chr5B 430441439 430443869 2430 False 3068 3068 89.510 5 2438 1 chr5B.!!$F1 2433
15 TraesCS3B01G381700 chr4B 155991476 155993890 2414 True 2924 2924 88.610 4 2417 1 chr4B.!!$R1 2413
16 TraesCS3B01G381700 chr4B 377197424 377199850 2426 True 2833 2833 87.796 4 2438 1 chr4B.!!$R3 2434
17 TraesCS3B01G381700 chr4B 339689950 339692376 2426 True 2687 2687 86.765 11 2438 1 chr4B.!!$R2 2427
18 TraesCS3B01G381700 chr1B 685068101 685070520 2419 False 2001 2001 81.714 4 2438 1 chr1B.!!$F1 2434

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
484 488 0.469917 GCATAGCAGTAGCCCCTGAA 59.53 55.0 4.49 0.0 43.56 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1713 1741 0.887247 TGTTTGCAATCCGGACATGG 59.113 50.0 6.12 0.0 0.0 3.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
484 488 0.469917 GCATAGCAGTAGCCCCTGAA 59.530 55.000 4.49 0.0 43.56 3.02
487 491 1.651737 TAGCAGTAGCCCCTGAAACA 58.348 50.000 4.49 0.0 43.56 2.83
668 682 8.865978 CATTTGTCTCAATTGTATGGAAATGTG 58.134 33.333 5.13 0.0 0.00 3.21
1055 1071 2.679837 CGTCTGCAGGTGATTTATTGCT 59.320 45.455 15.13 0.0 37.45 3.91
1501 1517 2.092753 AGATCATTTGTCATGGCGGACT 60.093 45.455 9.98 0.0 38.61 3.85
1524 1540 2.203126 GCTTCAGCCCCTGGATCG 60.203 66.667 0.00 0.0 34.31 3.69
1633 1649 6.540438 TGAATAGACAAGTACCCAACTAGG 57.460 41.667 0.00 0.0 37.50 3.02
1810 1842 3.002965 GTCTTTTGTTCACCGACCGAATT 59.997 43.478 0.00 0.0 0.00 2.17
2134 2173 2.127839 GGAGTGATCCGAGCATCCA 58.872 57.895 9.09 0.0 0.00 3.41
2233 2277 2.783288 GCGGGGGTAAGGAGACGAG 61.783 68.421 0.00 0.0 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2 3 3.461773 CCTGCCCGATCTGGACGT 61.462 66.667 7.45 0.00 42.00 4.34
314 318 1.361793 TATTGCAAAGTACGGACCGC 58.638 50.000 15.39 0.00 0.00 5.68
318 322 8.185505 GGAAAATATGTTATTGCAAAGTACGGA 58.814 33.333 1.71 0.00 0.00 4.69
484 488 5.104982 ACAGTTGTTCCAACCATTTCATGTT 60.105 36.000 3.61 0.00 0.00 2.71
487 491 5.612725 AACAGTTGTTCCAACCATTTCAT 57.387 34.783 3.61 0.00 31.64 2.57
737 751 1.950909 CTCGCTCTCCCTTACGATCTT 59.049 52.381 0.00 0.00 33.53 2.40
1055 1071 4.442052 GCTCATGCAACTGTGAGAGGTATA 60.442 45.833 17.26 0.00 43.50 1.47
1321 1337 6.739675 GGTCATACACCAGGCTATCTAGCTT 61.740 48.000 8.97 0.00 45.83 3.74
1322 1338 5.297162 GGTCATACACCAGGCTATCTAGCT 61.297 50.000 8.97 0.00 45.83 3.32
1323 1339 3.056465 GGTCATACACCAGGCTATCTAGC 60.056 52.174 0.40 0.40 45.98 3.42
1469 1485 4.946772 TGACAAATGATCTTTAATCCGGCA 59.053 37.500 0.00 0.00 0.00 5.69
1501 1517 1.357420 TCCAGGGGCTGAAGCAAAATA 59.643 47.619 4.43 0.00 44.36 1.40
1524 1540 4.246712 TCAGATATACCCCGGACTATCC 57.753 50.000 0.73 0.00 0.00 2.59
1538 1554 6.211584 ACATAACTGAGCGGGTATTCAGATAT 59.788 38.462 8.35 3.96 42.67 1.63
1713 1741 0.887247 TGTTTGCAATCCGGACATGG 59.113 50.000 6.12 0.00 0.00 3.66
1810 1842 3.975168 AGCTAGCGTTCTTAAGGGAAA 57.025 42.857 9.55 0.00 0.00 3.13
1937 1969 1.308783 GGGTTGCCTAGCTCTTGTGC 61.309 60.000 0.00 0.00 0.00 4.57
2233 2277 2.743928 CAGGGCCGAACTCAGTGC 60.744 66.667 0.00 0.00 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.