Multiple sequence alignment - TraesCS3B01G350000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G350000 chr3B 100.000 2888 0 0 1 2888 560060633 560057746 0 5334
1 TraesCS3B01G350000 chr5B 97.827 2899 49 7 1 2888 337439067 337436172 0 4992
2 TraesCS3B01G350000 chr5B 92.104 2837 193 21 72 2888 293192986 293190161 0 3969
3 TraesCS3B01G350000 chr7B 96.138 2900 97 8 1 2888 654664605 654667501 0 4721
4 TraesCS3B01G350000 chr7B 93.091 2779 168 12 122 2888 112225593 112222827 0 4047
5 TraesCS3B01G350000 chr7B 92.419 2836 158 35 72 2882 595538789 595541592 0 3993
6 TraesCS3B01G350000 chr7B 84.720 1250 115 43 1701 2888 242316054 242317289 0 1181
7 TraesCS3B01G350000 chr4B 95.166 2834 120 10 68 2888 349261051 349263880 0 4458
8 TraesCS3B01G350000 chr4B 94.296 2840 131 21 69 2888 102937921 102940749 0 4318
9 TraesCS3B01G350000 chr4B 93.039 2902 175 13 1 2888 560839096 560836208 0 4215
10 TraesCS3B01G350000 chr4B 93.523 2038 108 14 869 2888 412844894 412842863 0 3011
11 TraesCS3B01G350000 chr2B 92.604 2907 179 20 1 2888 606226535 606223646 0 4145
12 TraesCS3B01G350000 chr2B 93.337 1891 103 11 1 1874 272995441 272993557 0 2772
13 TraesCS3B01G350000 chr6B 85.469 2918 325 56 31 2888 120512665 120509787 0 2948
14 TraesCS3B01G350000 chr6B 93.168 1815 98 13 12 1806 463089359 463087551 0 2641
15 TraesCS3B01G350000 chr4A 86.162 2710 307 46 70 2745 113197758 113200433 0 2865
16 TraesCS3B01G350000 chr6A 85.461 2710 326 46 70 2745 481855718 481853043 0 2760
17 TraesCS3B01G350000 chr1A 84.394 1948 237 45 4 1925 311519860 311521766 0 1851


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G350000 chr3B 560057746 560060633 2887 True 5334 5334 100.000 1 2888 1 chr3B.!!$R1 2887
1 TraesCS3B01G350000 chr5B 337436172 337439067 2895 True 4992 4992 97.827 1 2888 1 chr5B.!!$R2 2887
2 TraesCS3B01G350000 chr5B 293190161 293192986 2825 True 3969 3969 92.104 72 2888 1 chr5B.!!$R1 2816
3 TraesCS3B01G350000 chr7B 654664605 654667501 2896 False 4721 4721 96.138 1 2888 1 chr7B.!!$F3 2887
4 TraesCS3B01G350000 chr7B 112222827 112225593 2766 True 4047 4047 93.091 122 2888 1 chr7B.!!$R1 2766
5 TraesCS3B01G350000 chr7B 595538789 595541592 2803 False 3993 3993 92.419 72 2882 1 chr7B.!!$F2 2810
6 TraesCS3B01G350000 chr7B 242316054 242317289 1235 False 1181 1181 84.720 1701 2888 1 chr7B.!!$F1 1187
7 TraesCS3B01G350000 chr4B 349261051 349263880 2829 False 4458 4458 95.166 68 2888 1 chr4B.!!$F2 2820
8 TraesCS3B01G350000 chr4B 102937921 102940749 2828 False 4318 4318 94.296 69 2888 1 chr4B.!!$F1 2819
9 TraesCS3B01G350000 chr4B 560836208 560839096 2888 True 4215 4215 93.039 1 2888 1 chr4B.!!$R2 2887
10 TraesCS3B01G350000 chr4B 412842863 412844894 2031 True 3011 3011 93.523 869 2888 1 chr4B.!!$R1 2019
11 TraesCS3B01G350000 chr2B 606223646 606226535 2889 True 4145 4145 92.604 1 2888 1 chr2B.!!$R2 2887
12 TraesCS3B01G350000 chr2B 272993557 272995441 1884 True 2772 2772 93.337 1 1874 1 chr2B.!!$R1 1873
13 TraesCS3B01G350000 chr6B 120509787 120512665 2878 True 2948 2948 85.469 31 2888 1 chr6B.!!$R1 2857
14 TraesCS3B01G350000 chr6B 463087551 463089359 1808 True 2641 2641 93.168 12 1806 1 chr6B.!!$R2 1794
15 TraesCS3B01G350000 chr4A 113197758 113200433 2675 False 2865 2865 86.162 70 2745 1 chr4A.!!$F1 2675
16 TraesCS3B01G350000 chr6A 481853043 481855718 2675 True 2760 2760 85.461 70 2745 1 chr6A.!!$R1 2675
17 TraesCS3B01G350000 chr1A 311519860 311521766 1906 False 1851 1851 84.394 4 1925 1 chr1A.!!$F1 1921

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
730 768 1.110442 CTCTCTCCGAGATGGTGCTT 58.89 55.0 0.0 0.0 42.62 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1956 2015 0.25064 CACCAACTGCAGCTCCTCTT 60.251 55.0 15.27 0.0 0.0 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 260 8.898761 TGCTATATTACAAACGATCATTTTGGT 58.101 29.630 17.04 2.98 38.12 3.67
730 768 1.110442 CTCTCTCCGAGATGGTGCTT 58.890 55.000 0.00 0.00 42.62 3.91
755 793 3.557054 GCTTGGTATCGATCCTTGCCATA 60.557 47.826 0.00 0.00 0.00 2.74
860 898 7.556635 AGATGAGATCTTCAATTTCATTCAGCA 59.443 33.333 0.00 0.00 39.77 4.41
1181 1219 4.338879 ACACAAAAGCATGAGCCTCTATT 58.661 39.130 0.00 0.00 43.56 1.73
1304 1343 6.387465 AGATTCAGTTTTGCATTGTGATGAG 58.613 36.000 0.00 0.00 35.16 2.90
1760 1816 4.202202 CGATGACTTAGAGGGCATTCTCTT 60.202 45.833 8.42 0.00 43.26 2.85
1831 1887 4.382291 TGTGTACCATTTACTGCGAGTTT 58.618 39.130 0.00 0.00 0.00 2.66
1956 2015 5.121811 GCATGAGGATAGAGAAGCAAAAGA 58.878 41.667 0.00 0.00 0.00 2.52
2011 2103 1.209261 TGCTACATCATCAAAGCCCGA 59.791 47.619 0.00 0.00 33.99 5.14
2852 3024 8.984764 CACAATCATCATTTGAACTTGTTGATT 58.015 29.630 7.35 7.35 40.38 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 1.346722 AGGTCGTTCCCAAAGATCGTT 59.653 47.619 0.00 0.0 38.55 3.85
497 535 2.102578 GCCCTGTGAAATAGCATTGGT 58.897 47.619 0.00 0.0 0.00 3.67
730 768 2.905075 CAAGGATCGATACCAAGCACA 58.095 47.619 3.31 0.0 0.00 4.57
860 898 2.093288 TCATTCAAGCTCTCGCCTTCAT 60.093 45.455 0.00 0.0 36.60 2.57
1181 1219 2.092968 AGCTCAACCTTGTCACACTGAA 60.093 45.455 0.00 0.0 0.00 3.02
1760 1816 3.561143 ACCAAGCCAATACAAGTGACAA 58.439 40.909 0.00 0.0 0.00 3.18
1831 1887 3.066342 GGAATGTCATCTCGAACTCGGTA 59.934 47.826 0.00 0.0 40.29 4.02
1956 2015 0.250640 CACCAACTGCAGCTCCTCTT 60.251 55.000 15.27 0.0 0.00 2.85
2011 2103 2.885135 TGGGTCATGAAACAGCTCAT 57.115 45.000 0.00 0.0 36.45 2.90
2276 2371 4.755266 AGGTGTATCGAGGTAAAAGCAT 57.245 40.909 0.00 0.0 0.00 3.79
2424 2519 4.164822 AGCACAAAAACAGGAATCATCG 57.835 40.909 0.00 0.0 0.00 3.84


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.