Multiple sequence alignment - TraesCS3B01G346100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G346100 chr3B 100.000 2411 0 0 1 2411 555553781 555551371 0.000000e+00 4453
1 TraesCS3B01G346100 chr3B 88.752 1218 82 22 1224 2411 685078796 685077604 0.000000e+00 1439
2 TraesCS3B01G346100 chr3D 94.240 2448 93 21 1 2411 16446569 16449005 0.000000e+00 3696
3 TraesCS3B01G346100 chr3D 88.734 1216 81 22 1221 2411 32171969 32173153 0.000000e+00 1435
4 TraesCS3B01G346100 chr5A 94.957 2340 65 18 1 2300 606397326 606395000 0.000000e+00 3618
5 TraesCS3B01G346100 chr5A 85.864 573 68 6 67 632 135038279 135037713 4.440000e-167 597
6 TraesCS3B01G346100 chr4A 97.462 1970 25 7 3 1965 729647899 729645948 0.000000e+00 3338
7 TraesCS3B01G346100 chr4A 97.927 579 11 1 1832 2409 729645949 729645371 0.000000e+00 1002
8 TraesCS3B01G346100 chr4A 97.222 72 2 0 1 72 729647826 729647755 3.260000e-24 122
9 TraesCS3B01G346100 chr4B 99.395 1818 9 2 596 2411 16784613 16786430 0.000000e+00 3295
10 TraesCS3B01G346100 chr4B 99.050 842 5 1 1 839 16783771 16784612 0.000000e+00 1507
11 TraesCS3B01G346100 chr7D 93.121 1730 60 11 706 2411 446553579 446551885 0.000000e+00 2481
12 TraesCS3B01G346100 chr2A 93.271 1397 56 12 1039 2411 46334480 46335862 0.000000e+00 2025
13 TraesCS3B01G346100 chr2A 95.829 1007 36 4 1 1001 46333474 46334480 0.000000e+00 1622
14 TraesCS3B01G346100 chr2A 88.811 715 59 10 1495 2202 363365172 363365872 0.000000e+00 857
15 TraesCS3B01G346100 chr2A 90.334 569 49 3 68 632 594379107 594378541 0.000000e+00 741
16 TraesCS3B01G346100 chr2A 87.267 322 34 6 631 947 648745695 648745376 6.340000e-96 361
17 TraesCS3B01G346100 chr6B 97.346 829 15 3 1142 1965 247037488 247036662 0.000000e+00 1402
18 TraesCS3B01G346100 chr6B 97.762 581 11 2 1832 2411 247036663 247036084 0.000000e+00 1000
19 TraesCS3B01G346100 chr6B 91.457 714 39 10 1495 2202 247042266 247041569 0.000000e+00 961
20 TraesCS3B01G346100 chr7A 96.406 473 14 3 1 471 321637382 321636911 0.000000e+00 776
21 TraesCS3B01G346100 chr7A 86.834 319 35 6 631 944 704664407 704664723 1.370000e-92 350
22 TraesCS3B01G346100 chr7A 97.222 72 2 0 1 72 321637307 321637236 3.260000e-24 122
23 TraesCS3B01G346100 chr3A 89.789 568 46 5 68 630 640035643 640035083 0.000000e+00 717
24 TraesCS3B01G346100 chr2B 85.442 577 70 7 67 635 31912766 31913336 2.670000e-164 588
25 TraesCS3B01G346100 chr1A 88.389 422 34 6 1224 1634 505878737 505878320 5.990000e-136 494
26 TraesCS3B01G346100 chr1D 86.404 456 41 8 942 1379 210228969 210228517 1.680000e-131 479
27 TraesCS3B01G346100 chr1D 87.770 139 16 1 941 1079 298144710 298144573 6.900000e-36 161
28 TraesCS3B01G346100 chr5B 86.031 451 42 7 944 1376 199657515 199657962 4.690000e-127 464
29 TraesCS3B01G346100 chr6D 85.000 460 41 11 942 1378 472510517 472510063 2.200000e-120 442
30 TraesCS3B01G346100 chrUn 100.000 128 0 0 1 128 476762808 476762935 1.110000e-58 237


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G346100 chr3B 555551371 555553781 2410 True 4453.000000 4453 100.0000 1 2411 1 chr3B.!!$R1 2410
1 TraesCS3B01G346100 chr3B 685077604 685078796 1192 True 1439.000000 1439 88.7520 1224 2411 1 chr3B.!!$R2 1187
2 TraesCS3B01G346100 chr3D 16446569 16449005 2436 False 3696.000000 3696 94.2400 1 2411 1 chr3D.!!$F1 2410
3 TraesCS3B01G346100 chr3D 32171969 32173153 1184 False 1435.000000 1435 88.7340 1221 2411 1 chr3D.!!$F2 1190
4 TraesCS3B01G346100 chr5A 606395000 606397326 2326 True 3618.000000 3618 94.9570 1 2300 1 chr5A.!!$R2 2299
5 TraesCS3B01G346100 chr5A 135037713 135038279 566 True 597.000000 597 85.8640 67 632 1 chr5A.!!$R1 565
6 TraesCS3B01G346100 chr4A 729645371 729647899 2528 True 1487.333333 3338 97.5370 1 2409 3 chr4A.!!$R1 2408
7 TraesCS3B01G346100 chr4B 16783771 16786430 2659 False 2401.000000 3295 99.2225 1 2411 2 chr4B.!!$F1 2410
8 TraesCS3B01G346100 chr7D 446551885 446553579 1694 True 2481.000000 2481 93.1210 706 2411 1 chr7D.!!$R1 1705
9 TraesCS3B01G346100 chr2A 46333474 46335862 2388 False 1823.500000 2025 94.5500 1 2411 2 chr2A.!!$F2 2410
10 TraesCS3B01G346100 chr2A 363365172 363365872 700 False 857.000000 857 88.8110 1495 2202 1 chr2A.!!$F1 707
11 TraesCS3B01G346100 chr2A 594378541 594379107 566 True 741.000000 741 90.3340 68 632 1 chr2A.!!$R1 564
12 TraesCS3B01G346100 chr6B 247036084 247037488 1404 True 1201.000000 1402 97.5540 1142 2411 2 chr6B.!!$R2 1269
13 TraesCS3B01G346100 chr6B 247041569 247042266 697 True 961.000000 961 91.4570 1495 2202 1 chr6B.!!$R1 707
14 TraesCS3B01G346100 chr3A 640035083 640035643 560 True 717.000000 717 89.7890 68 630 1 chr3A.!!$R1 562
15 TraesCS3B01G346100 chr2B 31912766 31913336 570 False 588.000000 588 85.4420 67 635 1 chr2B.!!$F1 568

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
222 230 5.348724 TCGCTGTCACAAAGATGTTCTATTC 59.651 40.0 0.0 0.0 37.82 1.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2004 2583 3.839293 GCTCGATAGCCCATAAGTACAG 58.161 50.0 0.0 0.0 43.4 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 230 5.348724 TCGCTGTCACAAAGATGTTCTATTC 59.651 40.000 0.00 0.00 37.82 1.75
2004 2583 4.455190 GGAGCAATAAGAAGGATCTCATGC 59.545 45.833 0.00 0.00 38.06 4.06
2005 2584 5.307204 GAGCAATAAGAAGGATCTCATGCT 58.693 41.667 10.69 10.69 44.55 3.79
2006 2585 5.064558 AGCAATAAGAAGGATCTCATGCTG 58.935 41.667 10.31 0.00 42.38 4.41
2007 2586 4.820716 GCAATAAGAAGGATCTCATGCTGT 59.179 41.667 0.00 0.00 36.38 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 230 3.958704 TCACAATACAGCAAACCAAACG 58.041 40.909 0.00 0.0 0.00 3.60
1022 1284 4.040461 CCCACCCTTCAGTATATTCGACAT 59.960 45.833 0.00 0.0 0.00 3.06
1124 1386 4.641396 TCGACATCTGAAAAGGTCACATT 58.359 39.130 0.00 0.0 31.13 2.71
1596 1868 6.493115 ACATACTTGAGCTAGCTGATAGTGAT 59.507 38.462 24.99 12.3 33.65 3.06
2004 2583 3.839293 GCTCGATAGCCCATAAGTACAG 58.161 50.000 0.00 0.0 43.40 2.74
2005 2584 3.936372 GCTCGATAGCCCATAAGTACA 57.064 47.619 0.00 0.0 43.40 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.