Multiple sequence alignment - TraesCS3B01G343700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G343700 chr3B 100.000 2504 0 0 1 2504 552490508 552488005 0 4625
1 TraesCS3B01G343700 chr5B 99.042 2504 19 5 1 2502 179239832 179237332 0 4486
2 TraesCS3B01G343700 chr5B 98.840 2500 25 4 1 2500 420729577 420727082 0 4453
3 TraesCS3B01G343700 chr5B 98.642 2504 27 7 1 2501 406858243 406860742 0 4429
4 TraesCS3B01G343700 chr2A 99.041 2503 19 5 1 2500 719466166 719463666 0 4484
5 TraesCS3B01G343700 chr7B 98.761 2503 25 6 1 2500 68109801 68107302 0 4446
6 TraesCS3B01G343700 chr7B 98.722 2504 27 5 1 2500 528912472 528909970 0 4442
7 TraesCS3B01G343700 chr6B 98.722 2504 24 7 1 2500 408674337 408671838 0 4440
8 TraesCS3B01G343700 chr6B 98.682 2504 27 6 1 2501 704838302 704840802 0 4436
9 TraesCS3B01G343700 chr7A 98.602 2504 30 5 1 2501 171431011 171428510 0 4425


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G343700 chr3B 552488005 552490508 2503 True 4625 4625 100.000 1 2504 1 chr3B.!!$R1 2503
1 TraesCS3B01G343700 chr5B 179237332 179239832 2500 True 4486 4486 99.042 1 2502 1 chr5B.!!$R1 2501
2 TraesCS3B01G343700 chr5B 420727082 420729577 2495 True 4453 4453 98.840 1 2500 1 chr5B.!!$R2 2499
3 TraesCS3B01G343700 chr5B 406858243 406860742 2499 False 4429 4429 98.642 1 2501 1 chr5B.!!$F1 2500
4 TraesCS3B01G343700 chr2A 719463666 719466166 2500 True 4484 4484 99.041 1 2500 1 chr2A.!!$R1 2499
5 TraesCS3B01G343700 chr7B 68107302 68109801 2499 True 4446 4446 98.761 1 2500 1 chr7B.!!$R1 2499
6 TraesCS3B01G343700 chr7B 528909970 528912472 2502 True 4442 4442 98.722 1 2500 1 chr7B.!!$R2 2499
7 TraesCS3B01G343700 chr6B 408671838 408674337 2499 True 4440 4440 98.722 1 2500 1 chr6B.!!$R1 2499
8 TraesCS3B01G343700 chr6B 704838302 704840802 2500 False 4436 4436 98.682 1 2501 1 chr6B.!!$F1 2500
9 TraesCS3B01G343700 chr7A 171428510 171431011 2501 True 4425 4425 98.602 1 2501 1 chr7A.!!$R1 2500

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
51 52 2.923121 ACAGTGTGTCTGATGTGCTTT 58.077 42.857 0.0 0.0 46.27 3.51 F
282 284 3.118956 ACATGACTAGGCTGAACACTAGC 60.119 47.826 0.0 0.0 40.19 3.42 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1150 1156 1.202879 TGTGATCTCAGGGCGGTTTTT 60.203 47.619 0.00 0.0 0.00 1.94 R
2440 2450 0.111061 TTCTGGCACTGGCTTGACAT 59.889 50.000 3.97 0.0 40.87 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 2.923121 ACAGTGTGTCTGATGTGCTTT 58.077 42.857 0.00 0.00 46.27 3.51
137 138 9.614792 AGTTTTAGTTCTAGTTGCCTTATATGG 57.385 33.333 0.14 0.14 0.00 2.74
282 284 3.118956 ACATGACTAGGCTGAACACTAGC 60.119 47.826 0.00 0.00 40.19 3.42
747 752 3.328505 CAAATCCAAAGCGGCAGAAAAT 58.671 40.909 1.45 0.00 33.14 1.82
1150 1156 3.323775 AGGGGGAGAAAAGTCTGTTACA 58.676 45.455 0.00 0.00 32.80 2.41
1442 1448 4.226427 AGCTAGCATTCAAATCAGGTCA 57.774 40.909 18.83 0.00 0.00 4.02
2094 2102 3.461061 GCAGTTATAGCAGCTGATGTCA 58.539 45.455 20.43 0.00 37.67 3.58
2495 2505 8.757877 TCCTTTTATCCCATCCTTTATTGTTTG 58.242 33.333 0.00 0.00 0.00 2.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
137 138 0.826062 ATGCTGGCAAAATGGGTAGC 59.174 50.000 0.00 0.0 0.00 3.58
144 145 3.688694 AACATGACATGCTGGCAAAAT 57.311 38.095 15.49 0.0 39.86 1.82
747 752 3.512724 AGAAAATACCTCGTTTCCTCCGA 59.487 43.478 0.00 0.0 34.85 4.55
1150 1156 1.202879 TGTGATCTCAGGGCGGTTTTT 60.203 47.619 0.00 0.0 0.00 1.94
2440 2450 0.111061 TTCTGGCACTGGCTTGACAT 59.889 50.000 3.97 0.0 40.87 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.