Multiple sequence alignment - TraesCS3B01G343600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G343600 chr3B 100.000 2924 0 0 1 2924 552478137 552481060 0 5400
1 TraesCS3B01G343600 chr5B 98.297 2936 33 7 1 2922 420717184 420720116 0 5129
2 TraesCS3B01G343600 chr5B 97.956 2935 39 11 1 2922 179227002 179229928 0 5068
3 TraesCS3B01G343600 chr5B 97.888 2936 42 10 1 2922 406870615 406867686 0 5060
4 TraesCS3B01G343600 chr7B 97.990 2935 43 7 1 2921 68097402 68100334 0 5079
5 TraesCS3B01G343600 chr7B 97.989 2934 40 9 1 2922 528879484 528882410 0 5073
6 TraesCS3B01G343600 chr6B 97.955 2934 42 8 1 2922 408661943 408664870 0 5070
7 TraesCS3B01G343600 chr6B 97.820 2936 44 10 1 2922 704850703 704847774 0 5049
8 TraesCS3B01G343600 chr2A 97.888 2935 41 11 1 2922 719453777 719456703 0 5057
9 TraesCS3B01G343600 chr2A 97.819 2935 44 10 1 2922 43380271 43383198 0 5048
10 TraesCS3B01G343600 chr4B 97.482 2939 50 13 1 2922 194219138 194222069 0 4996
11 TraesCS3B01G343600 chr7A 97.209 2938 41 16 1 2922 171418632 171421544 0 4933
12 TraesCS3B01G343600 chr1A 97.607 2340 39 6 595 2922 567477552 567475218 0 3995
13 TraesCS3B01G343600 chr1A 95.870 799 17 5 2135 2922 567471887 567471094 0 1279


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G343600 chr3B 552478137 552481060 2923 False 5400 5400 100.0000 1 2924 1 chr3B.!!$F1 2923
1 TraesCS3B01G343600 chr5B 420717184 420720116 2932 False 5129 5129 98.2970 1 2922 1 chr5B.!!$F2 2921
2 TraesCS3B01G343600 chr5B 179227002 179229928 2926 False 5068 5068 97.9560 1 2922 1 chr5B.!!$F1 2921
3 TraesCS3B01G343600 chr5B 406867686 406870615 2929 True 5060 5060 97.8880 1 2922 1 chr5B.!!$R1 2921
4 TraesCS3B01G343600 chr7B 68097402 68100334 2932 False 5079 5079 97.9900 1 2921 1 chr7B.!!$F1 2920
5 TraesCS3B01G343600 chr7B 528879484 528882410 2926 False 5073 5073 97.9890 1 2922 1 chr7B.!!$F2 2921
6 TraesCS3B01G343600 chr6B 408661943 408664870 2927 False 5070 5070 97.9550 1 2922 1 chr6B.!!$F1 2921
7 TraesCS3B01G343600 chr6B 704847774 704850703 2929 True 5049 5049 97.8200 1 2922 1 chr6B.!!$R1 2921
8 TraesCS3B01G343600 chr2A 719453777 719456703 2926 False 5057 5057 97.8880 1 2922 1 chr2A.!!$F2 2921
9 TraesCS3B01G343600 chr2A 43380271 43383198 2927 False 5048 5048 97.8190 1 2922 1 chr2A.!!$F1 2921
10 TraesCS3B01G343600 chr4B 194219138 194222069 2931 False 4996 4996 97.4820 1 2922 1 chr4B.!!$F1 2921
11 TraesCS3B01G343600 chr7A 171418632 171421544 2912 False 4933 4933 97.2090 1 2922 1 chr7A.!!$F1 2921
12 TraesCS3B01G343600 chr1A 567471094 567477552 6458 True 2637 3995 96.7385 595 2922 2 chr1A.!!$R1 2327

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
464 474 2.807967 CCTCGACAAACAGATTGCTTGA 59.192 45.455 0.0 0.0 43.13 3.02 F
1147 1159 1.136695 CAGCTCCTGTGGCAAAAACAA 59.863 47.619 0.0 0.0 0.00 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1401 1413 3.297134 TTCACAGCCTTCCTTGAAGTT 57.703 42.857 3.40 0.0 37.92 2.66 R
2492 2514 2.317040 TCAAGACCGTCTTCAGGTTCT 58.683 47.619 10.98 0.0 43.01 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 129 6.159293 GGAAAAGCAACTTGGAATAAAGAGG 58.841 40.000 0.0 0.00 0.00 3.69
464 474 2.807967 CCTCGACAAACAGATTGCTTGA 59.192 45.455 0.0 0.00 43.13 3.02
1147 1159 1.136695 CAGCTCCTGTGGCAAAAACAA 59.863 47.619 0.0 0.00 0.00 2.83
1171 1183 2.167281 GAGACAGATGAGCAAGCACCTA 59.833 50.000 0.0 0.00 0.00 3.08
1345 1357 1.754226 GGTTTGACACTTTGGAAGGCA 59.246 47.619 0.0 0.00 0.00 4.75
1356 1368 1.999648 TGGAAGGCACAAAAGAGCAT 58.000 45.000 0.0 0.00 0.00 3.79
1819 1831 5.772825 ACATAACTGCAACTTGACAACAT 57.227 34.783 0.0 0.00 0.00 2.71
1934 1947 1.069906 GCCAGACTAAGCACACAAACG 60.070 52.381 0.0 0.00 0.00 3.60
2025 2040 5.221106 CCTGCTCTTGATCAGAAAACAAACA 60.221 40.000 0.0 0.00 32.26 2.83
2341 2359 7.836842 AGTTGTGTTAGTTGGTGAAAGAAATT 58.163 30.769 0.0 0.00 0.00 1.82
2492 2514 6.094881 GTGCCTTATGGAACTAAGCACATTAA 59.905 38.462 7.3 0.00 38.90 1.40
2898 7053 0.251922 ACCAGGACATTGCAATGGCT 60.252 50.000 37.3 23.76 44.06 4.75
2922 7077 7.094205 GCTCAGTCAATTAAGAAAATCTTCCCA 60.094 37.037 0.0 0.00 37.89 4.37
2923 7078 8.704849 TCAGTCAATTAAGAAAATCTTCCCAA 57.295 30.769 0.0 0.00 37.89 4.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 129 4.261801 TCACAATAGCTTTCTTGCCTACC 58.738 43.478 0.00 0.00 0.00 3.18
464 474 4.634443 ACTGTCTTTGTGTAGTCGCTTTTT 59.366 37.500 0.00 0.00 0.00 1.94
783 794 6.089150 GCATCTTCTTTTGAGCATCTGTTTTC 59.911 38.462 0.00 0.00 34.92 2.29
1147 1159 1.558294 TGCTTGCTCATCTGTCTCCAT 59.442 47.619 0.00 0.00 0.00 3.41
1171 1183 1.274728 AGTCTCAGATTCTTGCGCTGT 59.725 47.619 9.73 0.00 0.00 4.40
1356 1368 7.255555 CCAATCTGTAAGGCATATGCATTGTAA 60.256 37.037 31.82 18.18 45.23 2.41
1401 1413 3.297134 TTCACAGCCTTCCTTGAAGTT 57.703 42.857 3.40 0.00 37.92 2.66
1819 1831 9.310449 GAGAGAAGGGTAATATGGTTATAGACA 57.690 37.037 0.00 0.00 0.00 3.41
2353 2374 6.708285 ACCCTTGTTACCTAAGAACAGTATG 58.292 40.000 0.00 0.00 46.00 2.39
2354 2375 6.947376 ACCCTTGTTACCTAAGAACAGTAT 57.053 37.500 0.00 0.00 38.03 2.12
2492 2514 2.317040 TCAAGACCGTCTTCAGGTTCT 58.683 47.619 10.98 0.00 43.01 3.01
2898 7053 8.704849 TTGGGAAGATTTTCTTAATTGACTGA 57.295 30.769 0.00 0.00 36.73 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.