Multiple sequence alignment - TraesCS3B01G320000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G320000 chr3B 100.000 2972 0 0 1 2972 518911766 518914737 0.000000e+00 5489.0
1 TraesCS3B01G320000 chr3B 98.162 2992 32 3 1 2972 515217205 515214217 0.000000e+00 5199.0
2 TraesCS3B01G320000 chr3B 98.558 2705 36 3 1 2705 516002433 515999732 0.000000e+00 4776.0
3 TraesCS3B01G320000 chr3B 98.484 2705 38 1 1 2705 515477457 515474756 0.000000e+00 4765.0
4 TraesCS3B01G320000 chr3B 98.338 2708 33 7 1 2705 516475435 516472737 0.000000e+00 4741.0
5 TraesCS3B01G320000 chr3B 89.344 1464 102 23 682 2133 755079304 755080725 0.000000e+00 1790.0
6 TraesCS3B01G320000 chr3B 90.592 287 7 2 2706 2972 518929498 518929784 2.180000e-96 363.0
7 TraesCS3B01G320000 chrUn 98.061 2992 34 4 1 2972 123878930 123881917 0.000000e+00 5182.0
8 TraesCS3B01G320000 chrUn 99.285 1398 10 0 962 2359 403845692 403847089 0.000000e+00 2527.0
9 TraesCS3B01G320000 chrUn 98.221 1068 16 1 127 1194 444224963 444223899 0.000000e+00 1864.0
10 TraesCS3B01G320000 chrUn 97.929 676 13 1 1 676 131522109 131521435 0.000000e+00 1170.0
11 TraesCS3B01G320000 chrUn 97.929 676 13 1 1 676 403140473 403141147 0.000000e+00 1170.0
12 TraesCS3B01G320000 chrUn 95.668 554 4 2 2439 2972 131896805 131896252 0.000000e+00 872.0
13 TraesCS3B01G320000 chrUn 90.244 287 8 2 2706 2972 467337857 467338143 1.010000e-94 357.0
14 TraesCS3B01G320000 chrUn 89.407 236 5 2 2757 2972 292074687 292074452 2.260000e-71 279.0
15 TraesCS3B01G320000 chrUn 89.407 236 5 2 2757 2972 350943479 350943714 2.260000e-71 279.0
16 TraesCS3B01G320000 chrUn 87.719 228 8 2 2765 2972 123970204 123970431 6.360000e-62 248.0
17 TraesCS3B01G320000 chr3A 88.977 1388 96 19 581 1961 701869204 701870541 0.000000e+00 1663.0
18 TraesCS3B01G320000 chr4B 90.493 284 12 8 2704 2972 334082695 334082978 7.830000e-96 361.0
19 TraesCS3B01G320000 chr4B 89.895 287 9 2 2706 2972 334088245 334088531 4.710000e-93 351.0
20 TraesCS3B01G320000 chr7B 89.199 287 11 2 2706 2972 263840114 263839828 1.020000e-89 340.0
21 TraesCS3B01G320000 chr4A 88.502 287 13 2 2706 2972 412267179 412267465 2.210000e-86 329.0
22 TraesCS3B01G320000 chr4A 95.139 144 6 1 2705 2848 585550457 585550315 2.980000e-55 226.0
23 TraesCS3B01G320000 chr4A 80.545 257 36 9 27 279 533195566 533195320 5.060000e-43 185.0
24 TraesCS3B01G320000 chr1B 84.000 100 14 2 2543 2641 496563384 496563482 8.770000e-16 95.3
25 TraesCS3B01G320000 chr7D 90.000 70 4 3 47 116 251352606 251352540 1.470000e-13 87.9
26 TraesCS3B01G320000 chr1D 80.734 109 17 4 2543 2648 371751869 371751976 6.830000e-12 82.4
27 TraesCS3B01G320000 chr1A 92.308 52 4 0 2543 2594 471490506 471490557 1.140000e-09 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G320000 chr3B 518911766 518914737 2971 False 5489 5489 100.000 1 2972 1 chr3B.!!$F1 2971
1 TraesCS3B01G320000 chr3B 515214217 515217205 2988 True 5199 5199 98.162 1 2972 1 chr3B.!!$R1 2971
2 TraesCS3B01G320000 chr3B 515999732 516002433 2701 True 4776 4776 98.558 1 2705 1 chr3B.!!$R3 2704
3 TraesCS3B01G320000 chr3B 515474756 515477457 2701 True 4765 4765 98.484 1 2705 1 chr3B.!!$R2 2704
4 TraesCS3B01G320000 chr3B 516472737 516475435 2698 True 4741 4741 98.338 1 2705 1 chr3B.!!$R4 2704
5 TraesCS3B01G320000 chr3B 755079304 755080725 1421 False 1790 1790 89.344 682 2133 1 chr3B.!!$F3 1451
6 TraesCS3B01G320000 chrUn 123878930 123881917 2987 False 5182 5182 98.061 1 2972 1 chrUn.!!$F1 2971
7 TraesCS3B01G320000 chrUn 403845692 403847089 1397 False 2527 2527 99.285 962 2359 1 chrUn.!!$F5 1397
8 TraesCS3B01G320000 chrUn 444223899 444224963 1064 True 1864 1864 98.221 127 1194 1 chrUn.!!$R4 1067
9 TraesCS3B01G320000 chrUn 131521435 131522109 674 True 1170 1170 97.929 1 676 1 chrUn.!!$R1 675
10 TraesCS3B01G320000 chrUn 403140473 403141147 674 False 1170 1170 97.929 1 676 1 chrUn.!!$F4 675
11 TraesCS3B01G320000 chrUn 131896252 131896805 553 True 872 872 95.668 2439 2972 1 chrUn.!!$R2 533
12 TraesCS3B01G320000 chr3A 701869204 701870541 1337 False 1663 1663 88.977 581 1961 1 chr3A.!!$F1 1380

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
292 294 7.606073 GGCAAGTGTTTCCCATTAAATATTTGT 59.394 33.333 11.05 0.0 33.05 2.83 F
1246 1262 3.935172 TCCCCAAAACAAGAATTTCCCT 58.065 40.909 0.00 0.0 0.00 4.20 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1246 1262 2.113774 CAGGCACTTGCACCTCCA 59.886 61.111 3.15 0.0 44.36 3.86 R
2848 2866 0.846693 ATTTCTATTGCCCGGCTCCT 59.153 50.000 11.61 0.0 0.00 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
292 294 7.606073 GGCAAGTGTTTCCCATTAAATATTTGT 59.394 33.333 11.05 0.00 33.05 2.83
1246 1262 3.935172 TCCCCAAAACAAGAATTTCCCT 58.065 40.909 0.00 0.00 0.00 4.20
1696 1714 1.139947 GACTTCTCGAGGCCGGAAG 59.860 63.158 13.56 20.74 42.89 3.46
2299 2317 6.821388 AGTACCATACACCTTCATCTTCATC 58.179 40.000 0.00 0.00 0.00 2.92
2300 2318 5.698741 ACCATACACCTTCATCTTCATCA 57.301 39.130 0.00 0.00 0.00 3.07
2848 2866 2.123425 CAGGAGGCGGCTAGGGTA 60.123 66.667 13.24 0.00 0.00 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 153 8.085296 TGTTGCAAAATTATCTTCCGTAACAAT 58.915 29.630 0.00 0.0 0.00 2.71
258 260 0.961019 GAAACACTTGCCATCAGCCA 59.039 50.000 0.00 0.0 42.71 4.75
723 732 2.208431 CTTCAACGATGAGGAGATGCC 58.792 52.381 0.00 0.0 36.78 4.40
827 839 2.235898 GTCCTTCTTGGTGATCTCTGCT 59.764 50.000 0.00 0.0 37.07 4.24
1246 1262 2.113774 CAGGCACTTGCACCTCCA 59.886 61.111 3.15 0.0 44.36 3.86
1696 1714 2.142292 ATCCTGTCCACCTTGCACCC 62.142 60.000 0.00 0.0 0.00 4.61
2741 2759 1.003573 CCCTCCTTCCCCTACAGCT 59.996 63.158 0.00 0.0 0.00 4.24
2848 2866 0.846693 ATTTCTATTGCCCGGCTCCT 59.153 50.000 11.61 0.0 0.00 3.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.