Multiple sequence alignment - TraesCS3B01G319900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G319900 chr3B 100.000 2972 0 0 1 2972 516002436 515999465 0.000000e+00 5489.0
1 TraesCS3B01G319900 chr3B 98.487 2975 37 4 4 2972 515477457 515474485 0.000000e+00 5238.0
2 TraesCS3B01G319900 chr3B 98.355 2978 32 7 4 2972 516475435 516472466 0.000000e+00 5212.0
3 TraesCS3B01G319900 chr3B 98.632 2704 33 3 4 2705 515217205 515214504 0.000000e+00 4785.0
4 TraesCS3B01G319900 chr3B 98.523 2708 37 3 1 2705 518911763 518914470 0.000000e+00 4776.0
5 TraesCS3B01G319900 chr3B 89.269 1463 104 21 683 2133 755079304 755080725 0.000000e+00 1783.0
6 TraesCS3B01G319900 chr3B 96.029 277 6 2 2701 2972 515164368 515164092 2.100000e-121 446.0
7 TraesCS3B01G319900 chr3B 95.652 276 8 1 2701 2972 518929816 518930091 9.780000e-120 440.0
8 TraesCS3B01G319900 chrUn 98.596 2706 35 2 1 2705 123878927 123881630 0.000000e+00 4783.0
9 TraesCS3B01G319900 chrUn 98.999 1398 14 0 962 2359 403845692 403847089 0.000000e+00 2505.0
10 TraesCS3B01G319900 chrUn 98.408 1068 14 2 128 1194 444224964 444223899 0.000000e+00 1875.0
11 TraesCS3B01G319900 chrUn 98.074 675 13 0 4 678 131522109 131521435 0.000000e+00 1175.0
12 TraesCS3B01G319900 chrUn 97.935 678 14 0 1 678 403140470 403141147 0.000000e+00 1175.0
13 TraesCS3B01G319900 chrUn 98.876 267 3 0 2439 2705 131896805 131896539 7.450000e-131 477.0
14 TraesCS3B01G319900 chrUn 96.377 276 6 1 2701 2972 4341334 4341609 4.520000e-123 451.0
15 TraesCS3B01G319900 chrUn 96.014 276 7 1 2701 2972 131823118 131822843 2.100000e-121 446.0
16 TraesCS3B01G319900 chrUn 95.652 276 8 1 2701 2972 123970463 123970738 9.780000e-120 440.0
17 TraesCS3B01G319900 chr3A 89.257 1387 92 19 583 1961 701869204 701870541 0.000000e+00 1683.0
18 TraesCS3B01G319900 chr4A 78.906 256 39 10 31 281 533195565 533195320 3.070000e-35 159.0
19 TraesCS3B01G319900 chr1B 84.000 100 14 2 2543 2641 496563384 496563482 8.770000e-16 95.3
20 TraesCS3B01G319900 chr7D 90.000 70 4 3 49 118 251352606 251352540 1.470000e-13 87.9
21 TraesCS3B01G319900 chr1D 80.734 109 17 4 2543 2648 371751869 371751976 6.830000e-12 82.4
22 TraesCS3B01G319900 chr1A 92.308 52 4 0 2543 2594 471490506 471490557 1.140000e-09 75.0
23 TraesCS3B01G319900 chr5D 94.595 37 2 0 249 285 420911625 420911589 1.150000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G319900 chr3B 515999465 516002436 2971 True 5489 5489 100.000 1 2972 1 chr3B.!!$R4 2971
1 TraesCS3B01G319900 chr3B 515474485 515477457 2972 True 5238 5238 98.487 4 2972 1 chr3B.!!$R3 2968
2 TraesCS3B01G319900 chr3B 516472466 516475435 2969 True 5212 5212 98.355 4 2972 1 chr3B.!!$R5 2968
3 TraesCS3B01G319900 chr3B 515214504 515217205 2701 True 4785 4785 98.632 4 2705 1 chr3B.!!$R2 2701
4 TraesCS3B01G319900 chr3B 518911763 518914470 2707 False 4776 4776 98.523 1 2705 1 chr3B.!!$F1 2704
5 TraesCS3B01G319900 chr3B 755079304 755080725 1421 False 1783 1783 89.269 683 2133 1 chr3B.!!$F3 1450
6 TraesCS3B01G319900 chrUn 123878927 123881630 2703 False 4783 4783 98.596 1 2705 1 chrUn.!!$F2 2704
7 TraesCS3B01G319900 chrUn 403845692 403847089 1397 False 2505 2505 98.999 962 2359 1 chrUn.!!$F5 1397
8 TraesCS3B01G319900 chrUn 444223899 444224964 1065 True 1875 1875 98.408 128 1194 1 chrUn.!!$R4 1066
9 TraesCS3B01G319900 chrUn 131521435 131522109 674 True 1175 1175 98.074 4 678 1 chrUn.!!$R1 674
10 TraesCS3B01G319900 chrUn 403140470 403141147 677 False 1175 1175 97.935 1 678 1 chrUn.!!$F4 677
11 TraesCS3B01G319900 chr3A 701869204 701870541 1337 False 1683 1683 89.257 583 1961 1 chr3A.!!$F1 1378

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
561 564 0.482446 ACCTGCCCACCTTCAAATCA 59.518 50.0 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2157 2178 6.156949 TGCAGATGGTAATAGTTTTCCTCTCT 59.843 38.462 0.0 0.0 0.0 3.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 113 4.863491 ACACAGATGATGTTGCAGAAAAC 58.137 39.130 0.00 0.0 41.41 2.43
237 240 1.982938 GTCACAGGGAGTAGGCGGT 60.983 63.158 0.00 0.0 0.00 5.68
508 511 1.258445 CCGACAGGCTGGGTCTAACT 61.258 60.000 20.34 0.0 33.11 2.24
561 564 0.482446 ACCTGCCCACCTTCAAATCA 59.518 50.000 0.00 0.0 0.00 2.57
1219 1238 2.364842 ACGGCCAGAGGATCAGCT 60.365 61.111 2.24 0.0 37.82 4.24
2157 2178 5.652014 ACCTCTGAAATGTGAACTTTGTGAA 59.348 36.000 0.00 0.0 0.00 3.18
2219 2240 8.592105 TTTCTCCAAAGCATTAGATTTTTGTG 57.408 30.769 0.00 0.0 29.40 3.33
2242 2263 7.708752 TGTGTATATATCATCTGTCAAAACGCA 59.291 33.333 0.00 0.0 0.00 5.24
2494 2515 2.079925 GTCCATCTGCCAGACTGTTTC 58.920 52.381 0.00 0.0 0.00 2.78
2750 2771 1.414919 TGACCACTTCCCTACACACAC 59.585 52.381 0.00 0.0 0.00 3.82
2845 2866 8.414003 TCTCTAATCTTAACTCATATTGTGCGT 58.586 33.333 0.00 0.0 0.00 5.24
2940 2965 4.524328 CCCAGAGCTTTCAGGTGTTTTAAT 59.476 41.667 0.00 0.0 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2 3 7.750229 ATATCACCTATATTGCAACAGGTTG 57.250 36.000 20.98 16.90 39.40 3.77
110 113 5.597813 AAAGACGAGAAAAGCTACACATG 57.402 39.130 0.00 0.00 0.00 3.21
113 116 7.583860 AAGATAAAGACGAGAAAAGCTACAC 57.416 36.000 0.00 0.00 0.00 2.90
508 511 1.954146 GGCTCGTCTTGTGCGTTCA 60.954 57.895 0.00 0.00 37.96 3.18
660 663 3.849563 TTGTGGTGCTTACCAGTTACT 57.150 42.857 0.00 0.00 41.00 2.24
1219 1238 5.903198 AATTCTTGTTTTGGGGATGGAAA 57.097 34.783 0.00 0.00 0.00 3.13
2157 2178 6.156949 TGCAGATGGTAATAGTTTTCCTCTCT 59.843 38.462 0.00 0.00 0.00 3.10
2219 2240 8.765219 AGTTGCGTTTTGACAGATGATATATAC 58.235 33.333 0.00 0.00 0.00 1.47
2242 2263 9.654663 GTAAAAACAGAGGTGTATATCTCAGTT 57.345 33.333 4.93 4.93 43.19 3.16
2845 2866 9.025041 TCAACTCAGATAACACAGAAGATAAGA 57.975 33.333 0.00 0.00 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.