Multiple sequence alignment - TraesCS3B01G319800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G319800 chr3B 100.000 2972 0 0 1 2972 515477460 515474489 0.000000e+00 5489.0
1 TraesCS3B01G319800 chr3B 98.588 2975 33 4 1 2972 516475438 516472470 0.000000e+00 5252.0
2 TraesCS3B01G319800 chr3B 98.485 2971 37 4 4 2972 516002433 515999469 0.000000e+00 5230.0
3 TraesCS3B01G319800 chr3B 98.817 2705 32 0 1 2705 515217208 515214504 0.000000e+00 4819.0
4 TraesCS3B01G319800 chr3B 98.486 2708 38 1 1 2705 518911763 518914470 0.000000e+00 4771.0
5 TraesCS3B01G319800 chr3B 89.269 1463 104 22 683 2133 755079304 755080725 0.000000e+00 1783.0
6 TraesCS3B01G319800 chr3B 97.802 273 5 1 2701 2972 515164368 515164096 1.250000e-128 470.0
7 TraesCS3B01G319800 chr3B 96.691 272 9 0 2701 2972 518929816 518930087 1.260000e-123 453.0
8 TraesCS3B01G319800 chrUn 98.743 2705 33 1 1 2705 123878927 123881630 0.000000e+00 4806.0
9 TraesCS3B01G319800 chrUn 99.142 1398 12 0 962 2359 403845692 403847089 0.000000e+00 2516.0
10 TraesCS3B01G319800 chrUn 98.404 1065 17 0 130 1194 444224963 444223899 0.000000e+00 1873.0
11 TraesCS3B01G319800 chrUn 97.644 679 15 1 1 679 131522112 131521435 0.000000e+00 1164.0
12 TraesCS3B01G319800 chrUn 97.644 679 15 1 1 679 403140470 403141147 0.000000e+00 1164.0
13 TraesCS3B01G319800 chrUn 99.251 267 2 0 2439 2705 131896805 131896539 1.600000e-132 483.0
14 TraesCS3B01G319800 chrUn 98.162 272 5 0 2701 2972 4341334 4341605 2.680000e-130 475.0
15 TraesCS3B01G319800 chrUn 97.794 272 6 0 2701 2972 131823118 131822847 1.250000e-128 470.0
16 TraesCS3B01G319800 chrUn 97.426 272 7 0 2701 2972 123970463 123970734 5.800000e-127 464.0
17 TraesCS3B01G319800 chr3A 89.177 1386 94 20 584 1961 701869204 701870541 0.000000e+00 1677.0
18 TraesCS3B01G319800 chr4A 80.078 256 37 8 31 282 533195565 533195320 8.470000e-41 178.0
19 TraesCS3B01G319800 chr1B 84.000 100 14 2 2543 2641 496563384 496563482 8.770000e-16 95.3
20 TraesCS3B01G319800 chr7D 90.000 70 4 3 50 119 251352606 251352540 1.470000e-13 87.9
21 TraesCS3B01G319800 chr1D 80.734 109 17 4 2543 2648 371751869 371751976 6.830000e-12 82.4
22 TraesCS3B01G319800 chr1A 92.308 52 4 0 2543 2594 471490506 471490557 1.140000e-09 75.0
23 TraesCS3B01G319800 chr5D 83.333 72 11 1 215 286 420911659 420911589 6.880000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G319800 chr3B 515474489 515477460 2971 True 5489 5489 100.000 1 2972 1 chr3B.!!$R3 2971
1 TraesCS3B01G319800 chr3B 516472470 516475438 2968 True 5252 5252 98.588 1 2972 1 chr3B.!!$R5 2971
2 TraesCS3B01G319800 chr3B 515999469 516002433 2964 True 5230 5230 98.485 4 2972 1 chr3B.!!$R4 2968
3 TraesCS3B01G319800 chr3B 515214504 515217208 2704 True 4819 4819 98.817 1 2705 1 chr3B.!!$R2 2704
4 TraesCS3B01G319800 chr3B 518911763 518914470 2707 False 4771 4771 98.486 1 2705 1 chr3B.!!$F1 2704
5 TraesCS3B01G319800 chr3B 755079304 755080725 1421 False 1783 1783 89.269 683 2133 1 chr3B.!!$F3 1450
6 TraesCS3B01G319800 chrUn 123878927 123881630 2703 False 4806 4806 98.743 1 2705 1 chrUn.!!$F2 2704
7 TraesCS3B01G319800 chrUn 403845692 403847089 1397 False 2516 2516 99.142 962 2359 1 chrUn.!!$F5 1397
8 TraesCS3B01G319800 chrUn 444223899 444224963 1064 True 1873 1873 98.404 130 1194 1 chrUn.!!$R4 1064
9 TraesCS3B01G319800 chrUn 131521435 131522112 677 True 1164 1164 97.644 1 679 1 chrUn.!!$R1 678
10 TraesCS3B01G319800 chrUn 403140470 403141147 677 False 1164 1164 97.644 1 679 1 chrUn.!!$F4 678
11 TraesCS3B01G319800 chr3A 701869204 701870541 1337 False 1677 1677 89.177 584 1961 1 chr3A.!!$F1 1377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
497 499 0.387929 AAACTGAGCGAACCGACAGA 59.612 50.0 15.96 0.0 36.75 3.41 F
647 649 0.531753 GAGCAGAGGAATCGGGAAGC 60.532 60.0 0.00 0.0 0.00 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1836 1857 0.876342 GCAGGTAATTCTCCTCGGCG 60.876 60.000 0.0 0.0 32.37 6.46 R
2434 2455 2.816087 GAGACTGAAAAGAAGCCATGCA 59.184 45.455 0.0 0.0 0.00 3.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
451 453 6.494491 TCTGACTGAAAATGAAAACCATGGAT 59.506 34.615 21.47 2.68 35.24 3.41
455 457 6.725834 ACTGAAAATGAAAACCATGGATACCT 59.274 34.615 21.47 0.00 35.24 3.08
456 458 7.093771 ACTGAAAATGAAAACCATGGATACCTC 60.094 37.037 21.47 7.85 35.24 3.85
497 499 0.387929 AAACTGAGCGAACCGACAGA 59.612 50.000 15.96 0.00 36.75 3.41
647 649 0.531753 GAGCAGAGGAATCGGGAAGC 60.532 60.000 0.00 0.00 0.00 3.86
1758 1779 1.984026 TGGAGACAGCATCGGAGCA 60.984 57.895 3.00 0.00 36.85 4.26
1836 1857 3.994392 TCTACTTTCTGAACAACATCGCC 59.006 43.478 0.00 0.00 0.00 5.54
1981 2002 2.288457 ACAGACGACTGACTTCATGTGG 60.288 50.000 21.50 0.00 46.03 4.17
2468 2489 0.617413 CAGTCTCCACAGCTCCCAAT 59.383 55.000 0.00 0.00 0.00 3.16
2740 2761 6.668541 ATGAATTGACTATTGACCACTTCG 57.331 37.500 0.00 0.00 0.00 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 204 0.526954 ACGCGTGTGTCTCTTTTCGT 60.527 50.000 12.93 0.00 0.00 3.85
451 453 5.603395 TCATATTTTACCCATCGGTGAGGTA 59.397 40.000 10.84 10.84 44.40 3.08
455 457 6.241882 TCTTCATATTTTACCCATCGGTGA 57.758 37.500 0.00 0.00 44.40 4.02
456 458 6.935741 TTCTTCATATTTTACCCATCGGTG 57.064 37.500 0.00 0.00 44.40 4.94
497 499 1.291272 GCGTTCGGTTAGACCCAGT 59.709 57.895 0.00 0.00 33.75 4.00
647 649 1.073177 GTTACCACCAACACGGATCG 58.927 55.000 0.00 0.00 38.63 3.69
1836 1857 0.876342 GCAGGTAATTCTCCTCGGCG 60.876 60.000 0.00 0.00 32.37 6.46
1981 2002 8.549338 ACTAGTACAGTGCTAAATTTTCCTTC 57.451 34.615 0.00 0.00 35.62 3.46
2434 2455 2.816087 GAGACTGAAAAGAAGCCATGCA 59.184 45.455 0.00 0.00 0.00 3.96
2722 2743 3.678056 AGCGAAGTGGTCAATAGTCAA 57.322 42.857 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.