Multiple sequence alignment - TraesCS3B01G319200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G319200 chr3B 100.000 2234 0 0 1 2234 513994773 513992540 0.000000e+00 4126
1 TraesCS3B01G319200 chr3D 98.257 2238 35 1 1 2234 394753129 394750892 0.000000e+00 3914
2 TraesCS3B01G319200 chr3A 96.607 2240 64 4 1 2234 514109643 514107410 0.000000e+00 3705
3 TraesCS3B01G319200 chr7A 83.636 220 34 2 2006 2225 216340846 216341063 2.910000e-49 206


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G319200 chr3B 513992540 513994773 2233 True 4126 4126 100.000 1 2234 1 chr3B.!!$R1 2233
1 TraesCS3B01G319200 chr3D 394750892 394753129 2237 True 3914 3914 98.257 1 2234 1 chr3D.!!$R1 2233
2 TraesCS3B01G319200 chr3A 514107410 514109643 2233 True 3705 3705 96.607 1 2234 1 chr3A.!!$R1 2233

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
651 652 0.451783 GTCCCATTGTCACCGCAATC 59.548 55.0 0.0 0.0 37.0 2.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1768 1775 0.694444 TGGGGCTTCCTGAGGGATAC 60.694 60.0 0.0 0.0 41.87 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
104 105 5.642491 CCATACAATGCTCATGAGAGTATGG 59.358 44.000 33.34 33.34 44.98 2.74
651 652 0.451783 GTCCCATTGTCACCGCAATC 59.548 55.000 0.00 0.00 37.00 2.67
804 805 4.878971 GCCTCAAAGGTTAAGATCTTCTCC 59.121 45.833 12.24 14.92 37.80 3.71
1035 1036 5.368145 GAACCATACACCAATGCAGAGATA 58.632 41.667 0.00 0.00 0.00 1.98
1371 1372 1.338674 TGATCGGCATTCTTCACGGTT 60.339 47.619 0.00 0.00 0.00 4.44
1464 1467 7.136822 TCAGGAAATCCTAAGCTTAGCATTA 57.863 36.000 25.38 12.01 46.65 1.90
1485 1488 1.939980 AAAGTAGGAAGAGCCGAGGT 58.060 50.000 0.00 0.00 43.43 3.85
1489 1492 2.025131 AGTAGGAAGAGCCGAGGTAGTT 60.025 50.000 0.00 0.00 43.43 2.24
1729 1732 3.460825 AGGGAGACAGGTTATTAAGGCA 58.539 45.455 0.00 0.00 0.00 4.75
1768 1775 7.810282 CCTTATGATGAACATACCTTAGTCTCG 59.190 40.741 0.00 0.00 40.62 4.04
1839 1846 3.538591 CTGCTGCATAGAGTTCATCCAA 58.461 45.455 1.31 0.00 0.00 3.53
1900 1907 1.588824 ATGTGCCGAACAGTGCATGG 61.589 55.000 0.00 0.00 43.64 3.66
2098 2105 5.548056 AGGAATCTGGAGGTTGAAGTCTTTA 59.452 40.000 0.00 0.00 0.00 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
104 105 4.616802 CGCAAAATTCACAGGTAACACATC 59.383 41.667 0.00 0.00 41.41 3.06
651 652 2.361757 TCAAACAGCCTGTGGAATTGTG 59.638 45.455 0.00 0.00 0.00 3.33
804 805 1.799181 CGTATCCGAGTCCAAGTGCTG 60.799 57.143 0.00 0.00 35.63 4.41
1035 1036 0.617413 AGCAAGCACTCATAGGCAGT 59.383 50.000 0.00 0.00 0.00 4.40
1464 1467 3.644335 ACCTCGGCTCTTCCTACTTTAT 58.356 45.455 0.00 0.00 0.00 1.40
1485 1488 9.880157 GGAAGAACAACACTGGTATATTAACTA 57.120 33.333 0.00 0.00 0.00 2.24
1489 1492 7.260387 TGGGAAGAACAACACTGGTATATTA 57.740 36.000 0.00 0.00 0.00 0.98
1729 1732 7.451255 TGTTCATCATAAGGAAAACATTCAGGT 59.549 33.333 0.00 0.00 33.10 4.00
1768 1775 0.694444 TGGGGCTTCCTGAGGGATAC 60.694 60.000 0.00 0.00 41.87 2.24
1839 1846 1.526575 CGGCAAACCAGATGCAACCT 61.527 55.000 0.00 0.00 45.60 3.50
2098 2105 2.368875 CAGGCCTAATATGACGGTCCTT 59.631 50.000 3.98 0.00 0.00 3.36
2191 2198 1.069204 CCCCAGATCAACGACGATGAT 59.931 52.381 19.08 19.08 40.14 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.